EMAIL THIS PAGE TO A FRIEND

UBE2E1

ubiquitin-conjugating enzyme E2E 1

Synonyms: UBCH6
UniProtKB ID: P51965, B2RBX4, C9J8K2, K4DI90
Gene ID:
Human(7324) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Mouse(22194) ubiquitin-conjugating enzyme E2E 1
Rat(100366017) ubiquitin-conjugating enzyme E2E 1
cow(615599) ubiquitin-conjugating enzyme E2E 1
sheep(101123528) ubiquitin-conjugating enzyme E2E 1
domestic guinea pig(100722231) ubiquitin-conjugating enzyme E2E 1
naked mole-rat(101701428) ubiquitin-conjugating enzyme E2E 1
Zebrafish(563542) ubiquitin-conjugating enzyme E2E 1
domestic cat(101082937) ubiquitin-conjugating enzyme E2E 1
dog(477048) ubiquitin-conjugating enzyme E2E 1
chicken(420653) ubiquitin-conjugating enzyme E2E 1 (UBC4/5 homolog, yeast)
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103798 Anti-UBE2E1 antibody produced in rabbit affinity isolated antibody , guinea pig, horse, rat, canine, human, mouse, rabbit
western blot pricing
SAB2106631 Anti-UBE2E1 antibody produced in rabbit affinity isolated antibody human, rabbit
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009455 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009455 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009455 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003341 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003341 Rosetta Predictions human pricing
NM_182666 Rosetta Predictions human pricing
NM_009455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147122 predicted 1026
2 SASI_Hs01_00147123 predicted 906
3 SASI_Hs01_00147124 predicted 973
4 SASI_Hs01_00147125 predicted 836
5 SASI_Hs01_00147126 predicted 609
6 SASI_Hs01_00147127 predicted 734
7 SASI_Hs01_00147128 predicted 975
8 SASI_Hs01_00147129 predicted 866
9 SASI_Hs01_00147131 predicted 627
10 SASI_Hs02_00335491 predicted 1048
11 SASI_Hs01_00147130 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173616 predicted 973
2 SASI_Hs01_00173617 predicted 860
3 SASI_Hs01_00173618 predicted 929
4 SASI_Hs01_00173619 predicted 781
5 SASI_Hs01_00173620 predicted 558
6 SASI_Hs01_00173621 predicted 687
7 SASI_Hs01_00173622 predicted 923
8 SASI_Hs01_00173623 predicted 810
9 SASI_Hs01_00173625 predicted 575
10 SASI_Hs02_00370843 predicted 1001
11 SASI_Hs01_00173624 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185830 predicted 518
2 SASI_Mm01_00185831 predicted 619
3 SASI_Mm01_00185832 predicted 525
4 SASI_Mm01_00185833 predicted 291
5 SASI_Mm01_00185834 predicted 359
6 SASI_Mm01_00185836 predicted 850
7 SASI_Mm01_00185837 predicted 469
8 SASI_Mm01_00185838 predicted 287
9 SASI_Mm01_00185839 predicted 684
10 SASI_Mm02_00316163 predicted 360
11 SASI_Mm01_00185835 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009455
VALIDATED
UBE2E1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2E 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009455.3-1161s21c1
Sequence:CCGGGAGTTTGTTACCTCGTATATGCTCGAGCATATACGAGGTAACAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009455.3-322s21c1
Sequence:CCGGTTCTCTCCACCAGCGCTAAGACTCGAGTCTTAGCGCTGGTGGAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009455.3-354s21c1
Sequence:CCGGGAGCTGGCAGACATCACTTTACTCGAGTAAAGTGATGTCTGCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009455.3-611s21c1
Sequence:CCGGCCCAGCCCTAACCATCTCGAACTCGAGTTCGAGATGGTTAGGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009455.3-419s21c1
Sequence:CCGGCTATGAGTGGAGATCAACCATCTCGAGATGGTTGATCTCCACTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009455.2-471s1c1
Sequence:CCGGTGGAGTATTCTTCCTTGACATCTCGAGATGTCAAGGAAGAATACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009455.2-612s1c1
Sequence:CCGGCCCAGCCCTAACCATCTCGAACTCGAGTTCGAGATGGTTAGGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009455.2-420s1c1
Sequence:CCGGCTATGAGTGGAGATCAACCATCTCGAGATGGTTGATCTCCACTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009455.2-524s1c1
Sequence:CCGGCAAAGGTTACATTTCGTACAACTCGAGTTGTACGAAATGTAACCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009455
VALIDATED
UBE2E1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2E 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009455.3-1161s21c1
Sequence:CCGGGAGTTTGTTACCTCGTATATGCTCGAGCATATACGAGGTAACAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009455.3-322s21c1
Sequence:CCGGTTCTCTCCACCAGCGCTAAGACTCGAGTCTTAGCGCTGGTGGAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009455.3-354s21c1
Sequence:CCGGGAGCTGGCAGACATCACTTTACTCGAGTAAAGTGATGTCTGCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009455.3-611s21c1
Sequence:CCGGCCCAGCCCTAACCATCTCGAACTCGAGTTCGAGATGGTTAGGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009455.3-419s21c1
Sequence:CCGGCTATGAGTGGAGATCAACCATCTCGAGATGGTTGATCTCCACTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009455.2-471s1c1
Sequence:CCGGTGGAGTATTCTTCCTTGACATCTCGAGATGTCAAGGAAGAATACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009455.2-612s1c1
Sequence:CCGGCCCAGCCCTAACCATCTCGAACTCGAGTTCGAGATGGTTAGGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009455.2-420s1c1
Sequence:CCGGCTATGAGTGGAGATCAACCATCTCGAGATGGTTGATCTCCACTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009455.2-524s1c1
Sequence:CCGGCAAAGGTTACATTTCGTACAACTCGAGTTGTACGAAATGTAACCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009455
VALIDATED
UBE2E1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2E 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009455.3-1161s21c1
Sequence:CCGGGAGTTTGTTACCTCGTATATGCTCGAGCATATACGAGGTAACAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009455.3-322s21c1
Sequence:CCGGTTCTCTCCACCAGCGCTAAGACTCGAGTCTTAGCGCTGGTGGAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009455.3-354s21c1
Sequence:CCGGGAGCTGGCAGACATCACTTTACTCGAGTAAAGTGATGTCTGCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009455.3-611s21c1
Sequence:CCGGCCCAGCCCTAACCATCTCGAACTCGAGTTCGAGATGGTTAGGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009455.3-419s21c1
Sequence:CCGGCTATGAGTGGAGATCAACCATCTCGAGATGGTTGATCTCCACTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009455.2-471s1c1
Sequence:CCGGTGGAGTATTCTTCCTTGACATCTCGAGATGTCAAGGAAGAATACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009455.2-612s1c1
Sequence:CCGGCCCAGCCCTAACCATCTCGAACTCGAGTTCGAGATGGTTAGGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009455.2-420s1c1
Sequence:CCGGCTATGAGTGGAGATCAACCATCTCGAGATGGTTGATCTCCACTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009455.2-524s1c1
Sequence:CCGGCAAAGGTTACATTTCGTACAACTCGAGTTGTACGAAATGTAACCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003341
VALIDATED
UBE2E1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2E 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003341.3-234s21c1
Sequence:CCGGGCAAACCGAGAAAGAAACAAACTCGAGTTTGTTTCTTTCTCGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003341.3-618s21c1
Sequence:CCGGCCTCCTTTCTATCTGCTCACTCTCGAGAGTGAGCAGATAGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003341.3-593s21c1
Sequence:CCGGGTCCAGCACTAACCATTTCTACTCGAGTAGAAATGGTTAGTGCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003341.3-840s21c1
Sequence:CCGGGTTGGTAAAGAGTAGGGTATTCTCGAGAATACCCTACTCTTTACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003341.x-840s1c1
Sequence:CCGGGTTGGTAAAGAGTAGGGTATTCTCGAGAATACCCTACTCTTTACCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003341.x-234s1c1
Sequence:CCGGGCAAACCGAGAAAGAAACAAACTCGAGTTTGTTTCTTTCTCGGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003341.x-593s1c1
Sequence:CCGGGTCCAGCACTAACCATTTCTACTCGAGTAGAAATGGTTAGTGCTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003341.x-440s1c1
Sequence:CCGGCCGTGTATGAGGGTGGTGTATCTCGAGATACACCACCCTCATACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003341.x-618s1c1
Sequence:CCGGCCTCCTTTCTATCTGCTCACTCTCGAGAGTGAGCAGATAGAAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003341
VALIDATED
UBE2E1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2E 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003341.3-234s21c1
Sequence:CCGGGCAAACCGAGAAAGAAACAAACTCGAGTTTGTTTCTTTCTCGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003341.3-618s21c1
Sequence:CCGGCCTCCTTTCTATCTGCTCACTCTCGAGAGTGAGCAGATAGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003341.3-593s21c1
Sequence:CCGGGTCCAGCACTAACCATTTCTACTCGAGTAGAAATGGTTAGTGCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003341.3-840s21c1
Sequence:CCGGGTTGGTAAAGAGTAGGGTATTCTCGAGAATACCCTACTCTTTACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003341.x-840s1c1
Sequence:CCGGGTTGGTAAAGAGTAGGGTATTCTCGAGAATACCCTACTCTTTACCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003341.x-234s1c1
Sequence:CCGGGCAAACCGAGAAAGAAACAAACTCGAGTTTGTTTCTTTCTCGGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003341.x-593s1c1
Sequence:CCGGGTCCAGCACTAACCATTTCTACTCGAGTAGAAATGGTTAGTGCTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003341.x-440s1c1
Sequence:CCGGCCGTGTATGAGGGTGGTGTATCTCGAGATACACCACCCTCATACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003341.x-618s1c1
Sequence:CCGGCCTCCTTTCTATCTGCTCACTCTCGAGAGTGAGCAGATAGAAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003341
VALIDATED
UBE2E1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2E 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003341.3-234s21c1
Sequence:CCGGGCAAACCGAGAAAGAAACAAACTCGAGTTTGTTTCTTTCTCGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003341.3-618s21c1
Sequence:CCGGCCTCCTTTCTATCTGCTCACTCTCGAGAGTGAGCAGATAGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003341.3-593s21c1
Sequence:CCGGGTCCAGCACTAACCATTTCTACTCGAGTAGAAATGGTTAGTGCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003341.3-840s21c1
Sequence:CCGGGTTGGTAAAGAGTAGGGTATTCTCGAGAATACCCTACTCTTTACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003341.x-840s1c1
Sequence:CCGGGTTGGTAAAGAGTAGGGTATTCTCGAGAATACCCTACTCTTTACCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003341.x-234s1c1
Sequence:CCGGGCAAACCGAGAAAGAAACAAACTCGAGTTTGTTTCTTTCTCGGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003341.x-593s1c1
Sequence:CCGGGTCCAGCACTAACCATTTCTACTCGAGTAGAAATGGTTAGTGCTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003341.x-440s1c1
Sequence:CCGGCCGTGTATGAGGGTGGTGTATCTCGAGATACACCACCCTCATACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003341.x-618s1c1
Sequence:CCGGCCTCCTTTCTATCTGCTCACTCTCGAGAGTGAGCAGATAGAAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks