EMAIL THIS PAGE TO A FRIEND

UBE2E2

ubiquitin-conjugating enzyme E2E 2

Synonyms: UBCH8
UniProtKB ID: Q96LR5
Gene ID:
Mouse(218793) ubiquitin-conjugating enzyme E2E 2
Rat(361013) ubiquitin-conjugating enzyme E2E 2
Zebrafish(445100) ubiquitin-conjugating enzyme E2E 2
chicken(776043) ubiquitin-conjugating enzyme E2E 2
domestic cat(101082513) ubiquitin-conjugating enzyme E2E 2
dog(610187) ubiquitin-conjugating enzyme E2E 2
naked mole-rat(101701059) ubiquitin-conjugating enzyme E2E 2
domestic guinea pig(100722511) ubiquitin-conjugating enzyme E2E 2
cow(784326) ubiquitin-conjugating enzyme E2E 2
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152653 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152653 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152653 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144839 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144839 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144839 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152653 Rosetta Predictions human pricing
NM_001108371 Rosetta Predictions rat pricing
NM_144839 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102037 predicted 408
2 SASI_Hs01_00102038 predicted 515
3 SASI_Hs01_00102039 predicted 599
4 SASI_Hs01_00102040 predicted 829
5 SASI_Hs01_00102041 predicted 672
6 SASI_Hs01_00102042 predicted 878
7 SASI_Hs01_00102043 predicted 611
8 SASI_Hs01_00102044 predicted 552
9 SASI_Hs01_00102045 predicted 573
10 SASI_Hs01_00102046 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108371 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238009 predicted 477
2 SASI_Rn02_00238010 predicted 625
3 SASI_Rn02_00238011 predicted 598
4 SASI_Rn02_00238012 predicted 364
5 SASI_Rn02_00238013 predicted 676
6 SASI_Rn02_00238014 predicted 323
7 SASI_Rn02_00238015 predicted 545
8 SASI_Rn02_00238016 predicted 482
9 SASI_Rn02_00238017 predicted 332
10 SASI_Rn02_00238018 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020236 predicted 567
2 SASI_Mm02_00340229 predicted 730
3 SASI_Mm01_00020238 predicted 447
4 SASI_Mm01_00020239 predicted 277
5 SASI_Mm01_00020240 predicted 278
6 SASI_Mm01_00020241 predicted 410
7 SASI_Mm01_00020243 predicted 691
8 SASI_Mm01_00020244 predicted 565
9 SASI_Mm01_00020245 predicted 666
10 SASI_Mm02_00340230 predicted 723
11 SASI_Mm01_00020237 predicted 285
12 SASI_Mm01_00020242 predicted 282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152653
VALIDATED
UBE2E2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2E 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152653.1-1083s1c1
Sequence:CCGGGCTTTCTTACAAAGCTTTGTACTCGAGTACAAAGCTTTGTAAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152653.1-226s1c1
Sequence:CCGGCGTGAAAGTGTTCAGCAAGAACTCGAGTTCTTGCTGAACACTTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152653.1-687s1c1
Sequence:CCGGCGCCACACAGTACATGACCAACTCGAGTTGGTCATGTACTGTGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152653.1-302s1c1
Sequence:CCGGCCGCTGCTAAATTGTCAACTACTCGAGTAGTTGACAATTTAGCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152653.1-212s1c1
Sequence:CCGGCCGATGGAGATCAACGTGAAACTCGAGTTTCACGTTGATCTCCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152653
VALIDATED
UBE2E2 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2E 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152653.1-1083s1c1
Sequence:CCGGGCTTTCTTACAAAGCTTTGTACTCGAGTACAAAGCTTTGTAAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152653.1-226s1c1
Sequence:CCGGCGTGAAAGTGTTCAGCAAGAACTCGAGTTCTTGCTGAACACTTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152653.1-687s1c1
Sequence:CCGGCGCCACACAGTACATGACCAACTCGAGTTGGTCATGTACTGTGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152653.1-302s1c1
Sequence:CCGGCCGCTGCTAAATTGTCAACTACTCGAGTAGTTGACAATTTAGCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152653.1-212s1c1
Sequence:CCGGCCGATGGAGATCAACGTGAAACTCGAGTTTCACGTTGATCTCCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152653
VALIDATED
UBE2E2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2E 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152653.1-1083s1c1
Sequence:CCGGGCTTTCTTACAAAGCTTTGTACTCGAGTACAAAGCTTTGTAAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152653.1-226s1c1
Sequence:CCGGCGTGAAAGTGTTCAGCAAGAACTCGAGTTCTTGCTGAACACTTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152653.1-687s1c1
Sequence:CCGGCGCCACACAGTACATGACCAACTCGAGTTGGTCATGTACTGTGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152653.1-302s1c1
Sequence:CCGGCCGCTGCTAAATTGTCAACTACTCGAGTAGTTGACAATTTAGCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152653.1-212s1c1
Sequence:CCGGCCGATGGAGATCAACGTGAAACTCGAGTTTCACGTTGATCTCCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144839
UBE2E2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2E 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144839.1-1169s1c1
Sequence:CCGGCCAATCAGAATCACTGTGCATCTCGAGATGCACAGTGATTCTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144839.1-284s1c1
Sequence:CCGGGACCCAAAGGAGACAACATTTCTCGAGAAATGTTGTCTCCTTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144839.1-86s1c1
Sequence:CCGGCAAGCACTAGTGGAGGAAGTTCTCGAGAACTTCCTCCACTAGTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144839.1-151s1c1
Sequence:CCGGGAACAAGTTCAGCCTAAGAAACTCGAGTTTCTTAGGCTGAACTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144839.1-425s1c1
Sequence:CCGGCGAGAATCTATCACTGTAATACTCGAGTATTACAGTGATAGATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144839
UBE2E2 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2E 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144839.1-1169s1c1
Sequence:CCGGCCAATCAGAATCACTGTGCATCTCGAGATGCACAGTGATTCTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144839.1-284s1c1
Sequence:CCGGGACCCAAAGGAGACAACATTTCTCGAGAAATGTTGTCTCCTTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144839.1-86s1c1
Sequence:CCGGCAAGCACTAGTGGAGGAAGTTCTCGAGAACTTCCTCCACTAGTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144839.1-151s1c1
Sequence:CCGGGAACAAGTTCAGCCTAAGAAACTCGAGTTTCTTAGGCTGAACTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144839.1-425s1c1
Sequence:CCGGCGAGAATCTATCACTGTAATACTCGAGTATTACAGTGATAGATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144839
UBE2E2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2E 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144839.1-1169s1c1
Sequence:CCGGCCAATCAGAATCACTGTGCATCTCGAGATGCACAGTGATTCTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144839.1-284s1c1
Sequence:CCGGGACCCAAAGGAGACAACATTTCTCGAGAAATGTTGTCTCCTTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144839.1-86s1c1
Sequence:CCGGCAAGCACTAGTGGAGGAAGTTCTCGAGAACTTCCTCCACTAGTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144839.1-151s1c1
Sequence:CCGGGAACAAGTTCAGCCTAAGAAACTCGAGTTTCTTAGGCTGAACTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144839.1-425s1c1
Sequence:CCGGCGAGAATCTATCACTGTAATACTCGAGTATTACAGTGATAGATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks