EMAIL THIS PAGE TO A FRIEND

UBE2E3

ubiquitin-conjugating enzyme E2E 3

Synonyms: UBCH9 UbcM2
UniProtKB ID: Q969T4, B2RAD6, D3DPG3, Q5U0R7, Q7Z4W4
Gene ID:
Human(10477) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein shares 100% sequence identity with the mouse and rat counterparts, which indicates that this enzyme is highly conserved in eukaryotes. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2013]
Mouse(22193) ubiquitin-conjugating enzyme E2E 3
Rat(295686) ubiquitin-conjugating enzyme E2E 3
Zebrafish(321689) ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast)
chicken(424122) ubiquitin-conjugating enzyme E2E 3
Horse(100067766) ubiquitin-conjugating enzyme E2E 3
domestic cat(101081321) ubiquitin-conjugating enzyme E2E 3
dog(612823) ubiquitin-conjugating enzyme E2E 3
cow(534349) ubiquitin-conjugating enzyme E2E 3
sheep(101121069) ubiquitin-conjugating enzyme E2E 3
domestic guinea pig(100718900) ubiquitin-conjugating enzyme E2E 3
naked mole-rat(101708301) ubiquitin-conjugating enzyme E2E 3
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009454 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009454 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009454 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006357 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006357 Rosetta Predictions human pricing
NM_182678 Rosetta Predictions human pricing
NM_001047857 Rosetta Predictions rat pricing
NM_009454 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107201 predicted 1088
2 SASI_Hs01_00107202 predicted 1192
3 SASI_Hs01_00107203 predicted 810
4 SASI_Hs01_00107204 predicted 1053
5 SASI_Hs01_00107206 predicted 757
6 SASI_Hs01_00107207 predicted 1291
7 SASI_Hs01_00107209 predicted 757
8 SASI_Hs02_00341408 predicted 1171
9 SASI_Hs02_00341409 predicted 740
10 SASI_Hs02_00341410 predicted 1159
11 SASI_Hs01_00107200 predicted 559
12 SASI_Hs01_00107205 predicted 850
13 SASI_Hs01_00107208 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220558 predicted 924
2 SASI_Hs01_00220559 predicted 1020
3 SASI_Hs01_00220560 predicted 641
4 SASI_Hs01_00220561 predicted 895
5 SASI_Hs01_00220563 predicted 595
6 SASI_Hs01_00220564 predicted 1121
7 SASI_Hs01_00220566 predicted 594
8 SASI_Hs02_00370845 predicted 1006
9 SASI_Hs02_00370846 predicted 574
10 SASI_Hs02_00370847 predicted 1000
11 SASI_Hs01_00220557 predicted 388
12 SASI_Hs01_00220562 predicted 690
13 SASI_Hs01_00220565 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047857 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206245 predicted 1001
2 SASI_Rn02_00206246 predicted 987
3 SASI_Rn02_00206247 predicted 1430
4 SASI_Rn02_00206248 predicted 1181
5 SASI_Rn02_00206249 predicted 1313
6 SASI_Rn02_00206250 predicted 1280
7 SASI_Rn02_00206251 predicted 1357
8 SASI_Rn02_00206252 predicted 1381
9 SASI_Rn02_00206253 predicted 1394
10 SASI_Rn02_00206254 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175896 predicted 1002
2 SASI_Mm01_00175897 predicted 1286
3 SASI_Mm02_00316161 predicted 1188
4 SASI_Mm02_00316162 predicted 1288
5 SASI_Mm01_00175898 predicted 1052
6 SASI_Mm01_00175901 predicted 992
7 SASI_Mm01_00175902 predicted 1060
8 SASI_Mm01_00175903 predicted 1172
9 SASI_Mm01_00175904 predicted 1167
10 SASI_Mm01_00175905 predicted 927
11 SASI_Mm01_00175899 predicted 1091
12 SASI_Mm01_00175900 predicted 1293
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009454
VALIDATED
UBE2E3 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2E 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009454.2-822s1c1
Sequence:CCGGCCTGGATATTCTGAAAGACAACTCGAGTTGTCTTTCAGAATATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009454.2-636s1c1
Sequence:CCGGTGGGCCTAAAGGAGATAACATCTCGAGATGTTATCTCCTTTAGGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009454.2-764s1c1
Sequence:CCGGAGGTTACTTTCCGTACCAGAACTCGAGTTCTGGTACGGAAAGTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009454.2-927s1c1
Sequence:CCGGCGGAAGCATAGCCACTCAGTACTCGAGTACTGAGTGGCTATGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009454.2-436s1c1
Sequence:CCGGAGTGGCAGTTCAGATGCAGATCTCGAGATCTGCATCTGAACTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009454
VALIDATED
UBE2E3 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2E 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009454.2-822s1c1
Sequence:CCGGCCTGGATATTCTGAAAGACAACTCGAGTTGTCTTTCAGAATATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009454.2-636s1c1
Sequence:CCGGTGGGCCTAAAGGAGATAACATCTCGAGATGTTATCTCCTTTAGGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009454.2-764s1c1
Sequence:CCGGAGGTTACTTTCCGTACCAGAACTCGAGTTCTGGTACGGAAAGTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009454.2-927s1c1
Sequence:CCGGCGGAAGCATAGCCACTCAGTACTCGAGTACTGAGTGGCTATGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009454.2-436s1c1
Sequence:CCGGAGTGGCAGTTCAGATGCAGATCTCGAGATCTGCATCTGAACTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009454
VALIDATED
UBE2E3 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2E 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009454.2-822s1c1
Sequence:CCGGCCTGGATATTCTGAAAGACAACTCGAGTTGTCTTTCAGAATATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009454.2-636s1c1
Sequence:CCGGTGGGCCTAAAGGAGATAACATCTCGAGATGTTATCTCCTTTAGGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009454.2-764s1c1
Sequence:CCGGAGGTTACTTTCCGTACCAGAACTCGAGTTCTGGTACGGAAAGTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009454.2-927s1c1
Sequence:CCGGCGGAAGCATAGCCACTCAGTACTCGAGTACTGAGTGGCTATGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009454.2-436s1c1
Sequence:CCGGAGTGGCAGTTCAGATGCAGATCTCGAGATCTGCATCTGAACTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006357
UBE2E3 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2E 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006357.2-1088s1c1
Sequence:CCGGCGGACTTCTGTGTATATGTTACTCGAGTAACATATACACAGAAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006357.2-548s1c1
Sequence:CCGGCCACTGCTAAGTTATCCACTACTCGAGTAGTGGATAACTTAGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006357.2-682s1c1
Sequence:CCGGCCACCGGGTTCTGTATATGAACTCGAGTTCATATACAGAACCCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006357.2-955s1c1
Sequence:CCGGAGAGCAGAACACGACAGGATACTCGAGTATCCTGTCGTGTTCTGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006357.2-850s1c1
Sequence:CCGGGCTTTGACTATTTCAAAGGTTCTCGAGAACCTTTGAAATAGTCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006357.2-548s21c1
Sequence:CCGGCCACTGCTAAGTTATCCACTACTCGAGTAGTGGATAACTTAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006357.2-1088s21c1
Sequence:CCGGCGGACTTCTGTGTATATGTTACTCGAGTAACATATACACAGAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006357.2-955s21c1
Sequence:CCGGAGAGCAGAACACGACAGGATACTCGAGTATCCTGTCGTGTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006357.2-682s21c1
Sequence:CCGGCCACCGGGTTCTGTATATGAACTCGAGTTCATATACAGAACCCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006357
UBE2E3 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2E 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006357.2-1088s1c1
Sequence:CCGGCGGACTTCTGTGTATATGTTACTCGAGTAACATATACACAGAAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006357.2-548s1c1
Sequence:CCGGCCACTGCTAAGTTATCCACTACTCGAGTAGTGGATAACTTAGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006357.2-682s1c1
Sequence:CCGGCCACCGGGTTCTGTATATGAACTCGAGTTCATATACAGAACCCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006357.2-955s1c1
Sequence:CCGGAGAGCAGAACACGACAGGATACTCGAGTATCCTGTCGTGTTCTGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006357.2-850s1c1
Sequence:CCGGGCTTTGACTATTTCAAAGGTTCTCGAGAACCTTTGAAATAGTCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006357.2-548s21c1
Sequence:CCGGCCACTGCTAAGTTATCCACTACTCGAGTAGTGGATAACTTAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006357.2-1088s21c1
Sequence:CCGGCGGACTTCTGTGTATATGTTACTCGAGTAACATATACACAGAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006357.2-955s21c1
Sequence:CCGGAGAGCAGAACACGACAGGATACTCGAGTATCCTGTCGTGTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006357.2-682s21c1
Sequence:CCGGCCACCGGGTTCTGTATATGAACTCGAGTTCATATACAGAACCCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006357
UBE2E3 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2E 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006357.2-1088s1c1
Sequence:CCGGCGGACTTCTGTGTATATGTTACTCGAGTAACATATACACAGAAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006357.2-548s1c1
Sequence:CCGGCCACTGCTAAGTTATCCACTACTCGAGTAGTGGATAACTTAGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006357.2-682s1c1
Sequence:CCGGCCACCGGGTTCTGTATATGAACTCGAGTTCATATACAGAACCCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006357.2-955s1c1
Sequence:CCGGAGAGCAGAACACGACAGGATACTCGAGTATCCTGTCGTGTTCTGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006357.2-850s1c1
Sequence:CCGGGCTTTGACTATTTCAAAGGTTCTCGAGAACCTTTGAAATAGTCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006357.2-548s21c1
Sequence:CCGGCCACTGCTAAGTTATCCACTACTCGAGTAGTGGATAACTTAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006357.2-1088s21c1
Sequence:CCGGCGGACTTCTGTGTATATGTTACTCGAGTAACATATACACAGAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006357.2-955s21c1
Sequence:CCGGAGAGCAGAACACGACAGGATACTCGAGTATCCTGTCGTGTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006357.2-682s21c1
Sequence:CCGGCCACCGGGTTCTGTATATGAACTCGAGTTCATATACAGAACCCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks