EMAIL THIS PAGE TO A FRIEND

UBE2F

ubiquitin-conjugating enzyme E2F (putative)

Synonyms: NCE2
Gene ID:
Mouse(67921) ubiquitin-conjugating enzyme E2F (putative)
Rat(363284) ubiquitin-conjugating enzyme E2F (putative)
Zebrafish(406606) ubiquitin-conjugating enzyme E2F (putative)
domestic cat(101087858) ubiquitin-conjugating enzyme E2F (putative)
dog(477421) ubiquitin-conjugating enzyme E2F (putative)
chicken(424015) ubiquitin-conjugating enzyme E2F (putative)
naked mole-rat(101720409) ubiquitin-conjugating enzyme E2F (putative)
domestic guinea pig(100728726) ubiquitin-conjugating enzyme E2F (putative)
cow(617083) ubiquitin-conjugating enzyme E2F (putative)
sheep(101123160) ubiquitin-conjugating enzyme E2F (putative)
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080678 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080678 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080678 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026454 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026454 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026454 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU164521 MISSION® esiRNA esiRNA targeting mouse Ube2f mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080678 Rosetta Predictions human pricing
NM_001008381 Rosetta Predictions rat pricing
NM_026454 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199216 predicted 864
2 SASI_Hs01_00199220 predicted 447
3 SASI_Hs02_00362455 predicted 598
4 SASI_Hs01_00199221 predicted 627
5 SASI_Hs01_00199222 predicted 259
6 SASI_Hs01_00199223 predicted 228
7 SASI_Hs02_00362456 predicted 340
8 SASI_Hs01_00199224 predicted 872
9 SASI_Hs01_00199225 predicted 421
10 SASI_Hs02_00362457 predicted 481
11 SASI_Hs01_00199217 predicted 683
12 SASI_Hs01_00199218 predicted 232
13 SASI_Hs01_00199219 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084258 predicted 250
2 SASI_Rn01_00084259 predicted 219
3 SASI_Rn01_00084260 predicted 789
4 SASI_Rn01_00084261 predicted 293
5 SASI_Rn01_00084262 predicted 775
6 SASI_Rn01_00084263 predicted 398
7 SASI_Rn01_00084264 predicted 350
8 SASI_Rn01_00084265 predicted 834
9 SASI_Rn01_00084266 predicted 776
10 SASI_Rn01_00084267 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195346 predicted 263
2 SASI_Mm01_00195348 predicted 275
3 SASI_Mm01_00195349 predicted 199
4 SASI_Mm01_00195345 predicted 857
5 SASI_Mm01_00195347 predicted 847
6 SASI_Mm01_00195350 predicted 925
7 SASI_Mm01_00195352 predicted 379
8 SASI_Mm01_00195354 predicted 977
9 SASI_Mm02_00330303 predicted 977
10 SASI_Mm01_00195351 predicted 185
11 SASI_Mm01_00195353 predicted 443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080678
UBE2F MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2F (putative)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080678.1-485s1c1
Sequence:CCGGCCCACAAGAACATTAAAGGATCTCGAGATCCTTTAATGTTCTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080678.1-1057s1c1
Sequence:CCGGGCAATAAGATACCCGCTACAACTCGAGTTGTAGCGGGTATCTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080678.1-378s1c1
Sequence:CCGGCCAAAGTGAAATGCCTGACCACTCGAGTGGTCAGGCATTTCACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080678.1-379s1c1
Sequence:CCGGCAAAGTGAAATGCCTGACCAACTCGAGTTGGTCAGGCATTTCACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080678.1-576s1c1
Sequence:CCGGCAGAACATCATTTGCGGGACACTCGAGTGTCCCGCAAATGATGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080678.1-620s21c1
Sequence:CCGGGATGACTACATCAAACGTTATCTCGAGATAACGTTTGATGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080678.1-1009s21c1
Sequence:CCGGTTCTGCACAAGCGATGCTAATCTCGAGATTAGCATCGCTTGTGCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080678.1-262s21c1
Sequence:CCGGTGATCCAAACAAGCTTCATTGCTCGAGCAATGAAGCTTGTTTGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080678
UBE2F MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2F (putative)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080678.1-485s1c1
Sequence:CCGGCCCACAAGAACATTAAAGGATCTCGAGATCCTTTAATGTTCTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080678.1-1057s1c1
Sequence:CCGGGCAATAAGATACCCGCTACAACTCGAGTTGTAGCGGGTATCTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080678.1-378s1c1
Sequence:CCGGCCAAAGTGAAATGCCTGACCACTCGAGTGGTCAGGCATTTCACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080678.1-379s1c1
Sequence:CCGGCAAAGTGAAATGCCTGACCAACTCGAGTTGGTCAGGCATTTCACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080678.1-576s1c1
Sequence:CCGGCAGAACATCATTTGCGGGACACTCGAGTGTCCCGCAAATGATGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080678.1-620s21c1
Sequence:CCGGGATGACTACATCAAACGTTATCTCGAGATAACGTTTGATGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080678.1-1009s21c1
Sequence:CCGGTTCTGCACAAGCGATGCTAATCTCGAGATTAGCATCGCTTGTGCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080678.1-262s21c1
Sequence:CCGGTGATCCAAACAAGCTTCATTGCTCGAGCAATGAAGCTTGTTTGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080678
UBE2F MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2F (putative)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080678.1-485s1c1
Sequence:CCGGCCCACAAGAACATTAAAGGATCTCGAGATCCTTTAATGTTCTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080678.1-1057s1c1
Sequence:CCGGGCAATAAGATACCCGCTACAACTCGAGTTGTAGCGGGTATCTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080678.1-378s1c1
Sequence:CCGGCCAAAGTGAAATGCCTGACCACTCGAGTGGTCAGGCATTTCACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080678.1-379s1c1
Sequence:CCGGCAAAGTGAAATGCCTGACCAACTCGAGTTGGTCAGGCATTTCACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080678.1-576s1c1
Sequence:CCGGCAGAACATCATTTGCGGGACACTCGAGTGTCCCGCAAATGATGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080678.1-620s21c1
Sequence:CCGGGATGACTACATCAAACGTTATCTCGAGATAACGTTTGATGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080678.1-1009s21c1
Sequence:CCGGTTCTGCACAAGCGATGCTAATCTCGAGATTAGCATCGCTTGTGCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080678.1-262s21c1
Sequence:CCGGTGATCCAAACAAGCTTCATTGCTCGAGCAATGAAGCTTGTTTGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026454
VALIDATED
UBE2F MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2F (putative)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026454.2-1367s1c1
Sequence:CCGGGCAATAAGAAACCCGCTATAACTCGAGTTATAGCGGGTTTCTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026454.2-541s1c1
Sequence:CCGGGCAGAACTTGAAGCTAATTTACTCGAGTAAATTAGCTTCAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026454.2-781s1c1
Sequence:CCGGGAACATTCAATTGATGGCACTCTCGAGAGTGCCATCAATTGAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026454.2-704s1c1
Sequence:CCGGCCAAGGTGAAATGCTTGACTACTCGAGTAGTCAAGCATTTCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026454.2-501s1c1
Sequence:CCGGGAGGGTTTCTGTGAGAGACAACTCGAGTTGTCTCTCACAGAAACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026454.3-219s21c1
Sequence:CCGGGAGGGTTTCTGTGAGAGACAACTCGAGTTGTCTCTCACAGAAACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026454.3-499s21c1
Sequence:CCGGGAACATTCAATTGATGGCACTCTCGAGAGTGCCATCAATTGAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026454.3-1085s21c1
Sequence:CCGGGCAATAAGAAACCCGCTATAACTCGAGTTATAGCGGGTTTCTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026454.3-259s21c1
Sequence:CCGGGCAGAACTTGAAGCTAATTTACTCGAGTAAATTAGCTTCAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026454.3-651s21c1
Sequence:CCGGTCGGGACAAAGTGGATGAATACTCGAGTATTCATCCACTTTGTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026454
VALIDATED
UBE2F MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2F (putative)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026454.2-1367s1c1
Sequence:CCGGGCAATAAGAAACCCGCTATAACTCGAGTTATAGCGGGTTTCTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026454.2-541s1c1
Sequence:CCGGGCAGAACTTGAAGCTAATTTACTCGAGTAAATTAGCTTCAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026454.2-781s1c1
Sequence:CCGGGAACATTCAATTGATGGCACTCTCGAGAGTGCCATCAATTGAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026454.2-704s1c1
Sequence:CCGGCCAAGGTGAAATGCTTGACTACTCGAGTAGTCAAGCATTTCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026454.2-501s1c1
Sequence:CCGGGAGGGTTTCTGTGAGAGACAACTCGAGTTGTCTCTCACAGAAACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026454.3-219s21c1
Sequence:CCGGGAGGGTTTCTGTGAGAGACAACTCGAGTTGTCTCTCACAGAAACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026454.3-499s21c1
Sequence:CCGGGAACATTCAATTGATGGCACTCTCGAGAGTGCCATCAATTGAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026454.3-1085s21c1
Sequence:CCGGGCAATAAGAAACCCGCTATAACTCGAGTTATAGCGGGTTTCTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026454.3-259s21c1
Sequence:CCGGGCAGAACTTGAAGCTAATTTACTCGAGTAAATTAGCTTCAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026454.3-651s21c1
Sequence:CCGGTCGGGACAAAGTGGATGAATACTCGAGTATTCATCCACTTTGTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026454
VALIDATED
UBE2F MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2F (putative)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026454.2-1367s1c1
Sequence:CCGGGCAATAAGAAACCCGCTATAACTCGAGTTATAGCGGGTTTCTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026454.2-541s1c1
Sequence:CCGGGCAGAACTTGAAGCTAATTTACTCGAGTAAATTAGCTTCAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026454.2-781s1c1
Sequence:CCGGGAACATTCAATTGATGGCACTCTCGAGAGTGCCATCAATTGAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026454.2-704s1c1
Sequence:CCGGCCAAGGTGAAATGCTTGACTACTCGAGTAGTCAAGCATTTCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026454.2-501s1c1
Sequence:CCGGGAGGGTTTCTGTGAGAGACAACTCGAGTTGTCTCTCACAGAAACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026454.3-219s21c1
Sequence:CCGGGAGGGTTTCTGTGAGAGACAACTCGAGTTGTCTCTCACAGAAACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026454.3-499s21c1
Sequence:CCGGGAACATTCAATTGATGGCACTCTCGAGAGTGCCATCAATTGAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026454.3-1085s21c1
Sequence:CCGGGCAATAAGAAACCCGCTATAACTCGAGTTATAGCGGGTTTCTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026454.3-259s21c1
Sequence:CCGGGCAGAACTTGAAGCTAATTTACTCGAGTAAATTAGCTTCAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026454.3-651s21c1
Sequence:CCGGTCGGGACAAAGTGGATGAATACTCGAGTATTCATCCACTTTGTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks