EMAIL THIS PAGE TO A FRIEND

UBE2G1

ubiquitin-conjugating enzyme E2G 1

Synonyms: E217K UBC7 UBE2G
UniProtKB ID: P62253, B2R7P2, D3DTK0, Q99462
Gene ID:
Human(7326) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family and catalyzes the covalent attachment of ubiquitin to other proteins. The protein may be involved in degradation of muscle-specific proteins. [provided by RefSeq, Jul 2008]
Mouse(67128) ubiquitin-conjugating enzyme E2G 1
Rat(64631) ubiquitin-conjugating enzyme E2G 1
chicken(770961) ubiquitin-conjugating enzyme E2G 1
domestic cat(101087018) ubiquitin-conjugating enzyme E2G 1
dog(100685242) ubiquitin-conjugating enzyme E2G 1
cow(613676) ubiquitin-conjugating enzyme E2G 1
sheep(101111725) ubiquitin-conjugating enzyme E2G 1
domestic guinea pig(100729908) ubiquitin-conjugating enzyme E2G 1
naked mole-rat(101698410) ubiquitin-conjugating enzyme E2G 1
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003342 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025985 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025985 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025985 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003342 Rosetta Predictions human pricing
NM_182682 Rosetta Predictions human pricing
NM_022690 Rosetta Predictions rat pricing
NM_025985 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219877 predicted 1129
2 SASI_Hs01_00219879 predicted 1109
3 SASI_Hs02_00335492 predicted 943
4 SASI_Hs01_00219881 predicted 1036
5 SASI_Hs02_00335493 predicted 878
6 SASI_Hs01_00219882 predicted 1053
7 SASI_Hs02_00335494 predicted 895
8 SASI_Hs01_00219883 predicted 1072
9 SASI_Hs02_00335495 predicted 389
10 SASI_Hs02_00335496 predicted 1145
11 SASI_Hs01_00219876 predicted 1001
12 SASI_Hs01_00219878 predicted 1185
13 SASI_Hs01_00219880 predicted 1190
14 SASI_Hs01_00219884 predicted 1365
15 SASI_Hs01_00219885 predicted 1358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210339 predicted 858
2 SASI_Hs01_00210340 predicted 906
3 SASI_Hs01_00210341 predicted 770
4 SASI_Hs01_00210342 predicted 778
5 SASI_Hs01_00210343 predicted 951
6 SASI_Hs01_00210344 predicted 617
7 SASI_Hs01_00210345 predicted 809
8 SASI_Hs01_00210346 predicted 862
9 SASI_Hs01_00210347 predicted 929
10 SASI_Hs01_00210348 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030697 predicted 828
2 SASI_Rn01_00030698 predicted 896
3 SASI_Rn01_00030699 predicted 812
4 SASI_Rn01_00030700 predicted 824
5 SASI_Rn01_00030701 predicted 900
6 SASI_Rn01_00030702 predicted 915
7 SASI_Rn01_00030703 predicted 405
8 SASI_Rn01_00030704 predicted 571
9 SASI_Rn01_00030705 predicted 742
10 SASI_Rn01_00030706 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329425 predicted 1103
2 SASI_Mm02_00329426 predicted 920
3 SASI_Mm02_00329427 predicted 847
4 SASI_Mm02_00329428 predicted 1049
5 SASI_Mm02_00329429 predicted 916
6 SASI_Mm02_00329430 predicted 863
7 SASI_Mm02_00329431 predicted 1104
8 SASI_Mm02_00329432 predicted 425
9 SASI_Mm02_00329433 predicted 792
10 SASI_Mm02_00329434 predicted 925
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003342
VALIDATED
UBE2G1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2G 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003342.4-467s21c1
Sequence:CCGGCGATGGGAAGTCCTTATTATTCTCGAGAATAATAAGGACTTCCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003342.4-1733s21c1
Sequence:CCGGGCCTGGTATTAAGGTTGGATACTCGAGTATCCAACCTTAATACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003342.4-491s21c1
Sequence:CCGGCCTCCAGATACACTTTATGAACTCGAGTTCATAAAGTGTATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003342.4-767s21c1
Sequence:CCGGGCTAATGTTGATGCTGCGAAACTCGAGTTTCGCAGCATCAACATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003342.3-771s1c1
Sequence:CCGGGCTAATGTTGATGCTGCGAAACTCGAGTTTCGCAGCATCAACATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003342.3-471s1c1
Sequence:CCGGCGATGGGAAGTCCTTATTATTCTCGAGAATAATAAGGACTTCCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003342.3-1737s1c1
Sequence:CCGGGCCTGGTATTAAGGTTGGATACTCGAGTATCCAACCTTAATACCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003342.3-441s1c1
Sequence:CCGGGCAGGTTTAATAGATGACAATCTCGAGATTGTCATCTATTAAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003342.3-495s1c1
Sequence:CCGGCCTCCAGATACACTTTATGAACTCGAGTTCATAAAGTGTATCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003342
VALIDATED
UBE2G1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2G 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003342.4-467s21c1
Sequence:CCGGCGATGGGAAGTCCTTATTATTCTCGAGAATAATAAGGACTTCCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003342.4-1733s21c1
Sequence:CCGGGCCTGGTATTAAGGTTGGATACTCGAGTATCCAACCTTAATACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003342.4-491s21c1
Sequence:CCGGCCTCCAGATACACTTTATGAACTCGAGTTCATAAAGTGTATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003342.4-767s21c1
Sequence:CCGGGCTAATGTTGATGCTGCGAAACTCGAGTTTCGCAGCATCAACATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003342.3-771s1c1
Sequence:CCGGGCTAATGTTGATGCTGCGAAACTCGAGTTTCGCAGCATCAACATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003342.3-471s1c1
Sequence:CCGGCGATGGGAAGTCCTTATTATTCTCGAGAATAATAAGGACTTCCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003342.3-1737s1c1
Sequence:CCGGGCCTGGTATTAAGGTTGGATACTCGAGTATCCAACCTTAATACCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003342.3-441s1c1
Sequence:CCGGGCAGGTTTAATAGATGACAATCTCGAGATTGTCATCTATTAAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003342.3-495s1c1
Sequence:CCGGCCTCCAGATACACTTTATGAACTCGAGTTCATAAAGTGTATCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003342
VALIDATED
UBE2G1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2G 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003342.4-467s21c1
Sequence:CCGGCGATGGGAAGTCCTTATTATTCTCGAGAATAATAAGGACTTCCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003342.4-1733s21c1
Sequence:CCGGGCCTGGTATTAAGGTTGGATACTCGAGTATCCAACCTTAATACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003342.4-491s21c1
Sequence:CCGGCCTCCAGATACACTTTATGAACTCGAGTTCATAAAGTGTATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003342.4-767s21c1
Sequence:CCGGGCTAATGTTGATGCTGCGAAACTCGAGTTTCGCAGCATCAACATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003342.3-771s1c1
Sequence:CCGGGCTAATGTTGATGCTGCGAAACTCGAGTTTCGCAGCATCAACATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003342.3-471s1c1
Sequence:CCGGCGATGGGAAGTCCTTATTATTCTCGAGAATAATAAGGACTTCCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003342.3-1737s1c1
Sequence:CCGGGCCTGGTATTAAGGTTGGATACTCGAGTATCCAACCTTAATACCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003342.3-441s1c1
Sequence:CCGGGCAGGTTTAATAGATGACAATCTCGAGATTGTCATCTATTAAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003342.3-495s1c1
Sequence:CCGGCCTCCAGATACACTTTATGAACTCGAGTTCATAAAGTGTATCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025985
VALIDATED
UBE2G1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2G 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025985.4-1426s21c1
Sequence:CCGGGCCAGAAAGTTCTCAAATCATCTCGAGATGATTTGAGAACTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025985.4-555s21c1
Sequence:CCGGACAGAGATTTGGCACCCAAATCTCGAGATTTGGGTGCCAAATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025985.4-588s21c1
Sequence:CCGGGGTGATGTTTGCATTTCTATTCTCGAGAATAGAAATGCAAACATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025985.4-705s21c1
Sequence:CCGGTCTATGCTGGCAGATCCTAATCTCGAGATTAGGATCTGCCAGCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025985.4-622s21c1
Sequence:CCGGGGGAGGATAAATATGGTTATGCTCGAGCATAACCATATTTATCCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025985.2-1306s1c1
Sequence:CCGGGCCAGAAAGTTCTCAAATCATCTCGAGATGATTTGAGAACTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025985.2-319s1c1
Sequence:CCGGCGTTGGGAAGTCCTTATTATTCTCGAGAATAATAAGGACTTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025985.2-619s1c1
Sequence:CCGGGCAAATGTAGATGCTGCGAAACTCGAGTTTCGCAGCATCTACATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025985.2-289s1c1
Sequence:CCGGGCAGGTTTAATAGACGACAATCTCGAGATTGTCGTCTATTAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025985.2-436s1c1
Sequence:CCGGACAGAGATTTGGCACCCAAATCTCGAGATTTGGGTGCCAAATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025985
VALIDATED
UBE2G1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2G 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025985.4-1426s21c1
Sequence:CCGGGCCAGAAAGTTCTCAAATCATCTCGAGATGATTTGAGAACTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025985.4-555s21c1
Sequence:CCGGACAGAGATTTGGCACCCAAATCTCGAGATTTGGGTGCCAAATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025985.4-588s21c1
Sequence:CCGGGGTGATGTTTGCATTTCTATTCTCGAGAATAGAAATGCAAACATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025985.4-705s21c1
Sequence:CCGGTCTATGCTGGCAGATCCTAATCTCGAGATTAGGATCTGCCAGCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025985.4-622s21c1
Sequence:CCGGGGGAGGATAAATATGGTTATGCTCGAGCATAACCATATTTATCCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025985.2-1306s1c1
Sequence:CCGGGCCAGAAAGTTCTCAAATCATCTCGAGATGATTTGAGAACTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025985.2-319s1c1
Sequence:CCGGCGTTGGGAAGTCCTTATTATTCTCGAGAATAATAAGGACTTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025985.2-619s1c1
Sequence:CCGGGCAAATGTAGATGCTGCGAAACTCGAGTTTCGCAGCATCTACATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025985.2-289s1c1
Sequence:CCGGGCAGGTTTAATAGACGACAATCTCGAGATTGTCGTCTATTAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025985.2-436s1c1
Sequence:CCGGACAGAGATTTGGCACCCAAATCTCGAGATTTGGGTGCCAAATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025985
VALIDATED
UBE2G1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2G 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025985.4-1426s21c1
Sequence:CCGGGCCAGAAAGTTCTCAAATCATCTCGAGATGATTTGAGAACTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025985.4-555s21c1
Sequence:CCGGACAGAGATTTGGCACCCAAATCTCGAGATTTGGGTGCCAAATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025985.4-588s21c1
Sequence:CCGGGGTGATGTTTGCATTTCTATTCTCGAGAATAGAAATGCAAACATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025985.4-705s21c1
Sequence:CCGGTCTATGCTGGCAGATCCTAATCTCGAGATTAGGATCTGCCAGCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025985.4-622s21c1
Sequence:CCGGGGGAGGATAAATATGGTTATGCTCGAGCATAACCATATTTATCCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025985.2-1306s1c1
Sequence:CCGGGCCAGAAAGTTCTCAAATCATCTCGAGATGATTTGAGAACTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025985.2-319s1c1
Sequence:CCGGCGTTGGGAAGTCCTTATTATTCTCGAGAATAATAAGGACTTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025985.2-619s1c1
Sequence:CCGGGCAAATGTAGATGCTGCGAAACTCGAGTTTCGCAGCATCTACATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025985.2-289s1c1
Sequence:CCGGGCAGGTTTAATAGACGACAATCTCGAGATTGTCGTCTATTAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025985.2-436s1c1
Sequence:CCGGACAGAGATTTGGCACCCAAATCTCGAGATTTGGGTGCCAAATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks