EMAIL THIS PAGE TO A FRIEND

UBE2G2

ubiquitin-conjugating enzyme E2G 2

Synonyms: UBC7
UniProtKB ID: P60604, A6NMQ7, A8K3L4, D3DSL7, P56554
Gene ID:
Human(7327) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein shares 100% sequence identity with the mouse counterpart. This gene is ubiquitously expressed, with high expression seen in adult muscle. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Mouse(22213) ubiquitin-conjugating enzyme E2G 2
Rat(294331) ubiquitin-conjugating enzyme E2G 2
Zebrafish(550464) ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast)
chicken(424837) ubiquitin-conjugating enzyme E2G 2
domestic cat(101088019) ubiquitin-conjugating enzyme E2G 2
dog(611581) ubiquitin-conjugating enzyme E2G 2
naked mole-rat(101701333) ubiquitin-conjugating enzyme E2G 2
domestic guinea pig(100718459) ubiquitin-conjugating enzyme E2G 2
cow(614471) ubiquitin-conjugating enzyme E2G 2
sheep(101109321) ubiquitin-conjugating enzyme E2G 2
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019803 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019803 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019803 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003343 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003343 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003343 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003343 Rosetta Predictions human pricing
NM_182688 Rosetta Predictions human pricing
NM_001106380 Rosetta Predictions rat pricing
NM_019803 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077052 predicted 1002
2 SASI_Hs01_00077053 predicted 945
3 SASI_Hs01_00077054 predicted 939
4 SASI_Hs01_00077055 predicted 945
5 SASI_Hs01_00077057 predicted 473
6 SASI_Hs01_00077058 predicted 941
7 SASI_Hs02_00335497 predicted 117
8 SASI_Hs01_00077059 predicted 806
9 SASI_Hs01_00077060 predicted 755
10 SASI_Hs01_00077061 predicted 183
11 SASI_Hs01_00077056 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037419 predicted 1113
2 SASI_Hs01_00037420 predicted 1060
3 SASI_Hs01_00037421 predicted 1054
4 SASI_Hs01_00037422 predicted 1058
5 SASI_Hs01_00037424 predicted 592
6 SASI_Hs01_00037425 predicted 1056
7 SASI_Hs01_00037426 predicted 925
8 SASI_Hs01_00037428 predicted 870
9 SASI_Hs02_00370854 predicted 303
10 SASI_Hs02_00370855 predicted 588
11 SASI_Hs01_00037423 predicted 444
12 SASI_Hs01_00037427 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106380 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218398 predicted 306
2 SASI_Rn02_00218399 predicted 941
3 SASI_Rn02_00218400 predicted 208
4 SASI_Rn02_00218401 predicted 921
5 SASI_Rn02_00218402 predicted 207
6 SASI_Rn02_00218403 predicted 590
7 SASI_Rn02_00218404 predicted 959
8 SASI_Rn02_00218405 predicted 514
9 SASI_Rn02_00218406 predicted 976
10 SASI_Rn02_00218407 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325055 predicted 1003
2 SASI_Mm01_00177549 predicted 326
3 SASI_Mm01_00177548 predicted 675
4 SASI_Mm01_00177551 predicted 332
5 SASI_Mm01_00177553 predicted 560
6 SASI_Mm01_00177555 predicted 1020
7 SASI_Mm01_00177556 predicted 218
8 SASI_Mm02_00325056 predicted 455
9 SASI_Mm01_00177557 predicted 991
10 SASI_Mm02_00325057 predicted 223
11 SASI_Mm01_00177550 predicted 948
12 SASI_Mm01_00177552 predicted 282
13 SASI_Mm01_00177554 predicted 570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019803
VALIDATED
UBE2G2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2G 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019803.2-500s1c1
Sequence:CCGGGCAGTTCTACAAGATCGCCAACTCGAGTTGGCGATCTTGTAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019803.2-224s1c1
Sequence:CCGGCCTGAGTTTCCCACTTGACTACTCGAGTAGTCAAGTGGGAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019803.2-89s1c1
Sequence:CCGGGTATAAGCAATTAACCCTGAACTCGAGTTCAGGGTTAATTGCTTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019803.2-80s1c1
Sequence:CCGGGATGGCTGAGTATAAGCAATTCTCGAGAATTGCTTATACTCAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019803.2-288s1c1
Sequence:CCGGCATCCCAATATCTATCCTGATCTCGAGATCAGGATAGATATTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019803.3-224s21c1
Sequence:CCGGCCTGAGTTTCCCACTTGACTACTCGAGTAGTCAAGTGGGAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019803.3-500s21c1
Sequence:CCGGGCAGTTCTACAAGATCGCCAACTCGAGTTGGCGATCTTGTAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019803.3-343s21c1
Sequence:CCGGGTGATGATCCCATGGGTTATGCTCGAGCATAACCCATGGGATCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019803.3-252s21c1
Sequence:CCGGAGCCCTCCGAAGATGAGATTCCTCGAGGAATCTCATCTTCGGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019803.3-850s21c1
Sequence:CCGGTGCCAGGGACTGGATACTAATCTCGAGATTAGTATCCAGTCCCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019803
VALIDATED
UBE2G2 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2G 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019803.2-500s1c1
Sequence:CCGGGCAGTTCTACAAGATCGCCAACTCGAGTTGGCGATCTTGTAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019803.2-224s1c1
Sequence:CCGGCCTGAGTTTCCCACTTGACTACTCGAGTAGTCAAGTGGGAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019803.2-89s1c1
Sequence:CCGGGTATAAGCAATTAACCCTGAACTCGAGTTCAGGGTTAATTGCTTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019803.2-80s1c1
Sequence:CCGGGATGGCTGAGTATAAGCAATTCTCGAGAATTGCTTATACTCAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019803.2-288s1c1
Sequence:CCGGCATCCCAATATCTATCCTGATCTCGAGATCAGGATAGATATTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019803.3-224s21c1
Sequence:CCGGCCTGAGTTTCCCACTTGACTACTCGAGTAGTCAAGTGGGAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019803.3-500s21c1
Sequence:CCGGGCAGTTCTACAAGATCGCCAACTCGAGTTGGCGATCTTGTAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019803.3-343s21c1
Sequence:CCGGGTGATGATCCCATGGGTTATGCTCGAGCATAACCCATGGGATCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019803.3-252s21c1
Sequence:CCGGAGCCCTCCGAAGATGAGATTCCTCGAGGAATCTCATCTTCGGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019803.3-850s21c1
Sequence:CCGGTGCCAGGGACTGGATACTAATCTCGAGATTAGTATCCAGTCCCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019803
VALIDATED
UBE2G2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2G 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019803.2-500s1c1
Sequence:CCGGGCAGTTCTACAAGATCGCCAACTCGAGTTGGCGATCTTGTAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019803.2-224s1c1
Sequence:CCGGCCTGAGTTTCCCACTTGACTACTCGAGTAGTCAAGTGGGAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019803.2-89s1c1
Sequence:CCGGGTATAAGCAATTAACCCTGAACTCGAGTTCAGGGTTAATTGCTTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019803.2-80s1c1
Sequence:CCGGGATGGCTGAGTATAAGCAATTCTCGAGAATTGCTTATACTCAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019803.2-288s1c1
Sequence:CCGGCATCCCAATATCTATCCTGATCTCGAGATCAGGATAGATATTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019803.3-224s21c1
Sequence:CCGGCCTGAGTTTCCCACTTGACTACTCGAGTAGTCAAGTGGGAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019803.3-500s21c1
Sequence:CCGGGCAGTTCTACAAGATCGCCAACTCGAGTTGGCGATCTTGTAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019803.3-343s21c1
Sequence:CCGGGTGATGATCCCATGGGTTATGCTCGAGCATAACCCATGGGATCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019803.3-252s21c1
Sequence:CCGGAGCCCTCCGAAGATGAGATTCCTCGAGGAATCTCATCTTCGGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019803.3-850s21c1
Sequence:CCGGTGCCAGGGACTGGATACTAATCTCGAGATTAGTATCCAGTCCCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003343
VALIDATED
UBE2G2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2G 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003343.x-465s1c1
Sequence:CCGGCAATGACGAAAGTGGAGCTAACTCGAGTTAGCTCCACTTTCGTCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003343.x-285s1c1
Sequence:CCGGGATGAGATTTACCTGTGAGATCTCGAGATCTCACAGGTAAATCTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003343.x-1566s1c1
Sequence:CCGGCGACCATACTCATCAAAGATTCTCGAGAATCTTTGATGAGTATGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003343.x-251s1c1
Sequence:CCGGGTTTCCCACTTGATTACCCGTCTCGAGACGGGTAATCAAGTGGGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003343.x-288s1c1
Sequence:CCGGGAGATTTACCTGTGAGATGTTCTCGAGAACATCTCACAGGTAAATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003343.4-105s21c1
Sequence:CCGGGGCCGAGTACAAACAATTAACCTCGAGGTTAATTGTTTGTACTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003343.4-285s21c1
Sequence:CCGGGATGAGATTTACCTGTGAGATCTCGAGATCTCACAGGTAAATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003343.4-1566s21c1
Sequence:CCGGCGACCATACTCATCAAAGATTCTCGAGAATCTTTGATGAGTATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003343.4-514s21c1
Sequence:CCGGGACCGGGAGCAGTTCTATAAGCTCGAGCTTATAGAACTGCTCCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003343.4-327s21c1
Sequence:CCGGTGATGGGAGAGTCTGCATTTCCTCGAGGAAATGCAGACTCTCCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003343
VALIDATED
UBE2G2 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2G 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003343.x-465s1c1
Sequence:CCGGCAATGACGAAAGTGGAGCTAACTCGAGTTAGCTCCACTTTCGTCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003343.x-285s1c1
Sequence:CCGGGATGAGATTTACCTGTGAGATCTCGAGATCTCACAGGTAAATCTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003343.x-1566s1c1
Sequence:CCGGCGACCATACTCATCAAAGATTCTCGAGAATCTTTGATGAGTATGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003343.x-251s1c1
Sequence:CCGGGTTTCCCACTTGATTACCCGTCTCGAGACGGGTAATCAAGTGGGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003343.x-288s1c1
Sequence:CCGGGAGATTTACCTGTGAGATGTTCTCGAGAACATCTCACAGGTAAATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003343.4-105s21c1
Sequence:CCGGGGCCGAGTACAAACAATTAACCTCGAGGTTAATTGTTTGTACTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003343.4-285s21c1
Sequence:CCGGGATGAGATTTACCTGTGAGATCTCGAGATCTCACAGGTAAATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003343.4-1566s21c1
Sequence:CCGGCGACCATACTCATCAAAGATTCTCGAGAATCTTTGATGAGTATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003343.4-514s21c1
Sequence:CCGGGACCGGGAGCAGTTCTATAAGCTCGAGCTTATAGAACTGCTCCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003343.4-327s21c1
Sequence:CCGGTGATGGGAGAGTCTGCATTTCCTCGAGGAAATGCAGACTCTCCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003343
VALIDATED
UBE2G2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2G 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003343.x-465s1c1
Sequence:CCGGCAATGACGAAAGTGGAGCTAACTCGAGTTAGCTCCACTTTCGTCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003343.x-285s1c1
Sequence:CCGGGATGAGATTTACCTGTGAGATCTCGAGATCTCACAGGTAAATCTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003343.x-1566s1c1
Sequence:CCGGCGACCATACTCATCAAAGATTCTCGAGAATCTTTGATGAGTATGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003343.x-251s1c1
Sequence:CCGGGTTTCCCACTTGATTACCCGTCTCGAGACGGGTAATCAAGTGGGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003343.x-288s1c1
Sequence:CCGGGAGATTTACCTGTGAGATGTTCTCGAGAACATCTCACAGGTAAATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003343.4-105s21c1
Sequence:CCGGGGCCGAGTACAAACAATTAACCTCGAGGTTAATTGTTTGTACTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003343.4-285s21c1
Sequence:CCGGGATGAGATTTACCTGTGAGATCTCGAGATCTCACAGGTAAATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003343.4-1566s21c1
Sequence:CCGGCGACCATACTCATCAAAGATTCTCGAGAATCTTTGATGAGTATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003343.4-514s21c1
Sequence:CCGGGACCGGGAGCAGTTCTATAAGCTCGAGCTTATAGAACTGCTCCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003343.4-327s21c1
Sequence:CCGGTGATGGGAGAGTCTGCATTTCCTCGAGGAAATGCAGACTCTCCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks