EMAIL THIS PAGE TO A FRIEND

UBE2H

ubiquitin-conjugating enzyme E2H

Synonyms: E2-20K GID3 UBC8 UBCH UBCH2
UniProtKB ID: P62256, A4D1L6, C9JY93, P37286, Q7Z6F4
Gene ID:
Human(7328) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein sequence is 100% identical to the mouse homolog and 98% identical to the frog and zebrafish homologs. Three alternatively spliced transcript variants have been found for this gene and they encode distinct isoforms. [provided by RefSeq, Feb 2011]
Mouse(22214) ubiquitin-conjugating enzyme E2H
Rat(296956) ubiquitin-conjugating enzyme E2H
cow(539313) ubiquitin-conjugating enzyme E2H
sheep(101115024) ubiquitin-conjugating enzyme E2H
domestic guinea pig(100721172) ubiquitin-conjugating enzyme E2H
naked mole-rat(101702456) ubiquitin-conjugating enzyme E2H
Zebrafish(368425) ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast)
domestic cat(101086130) ubiquitin-conjugating enzyme E2H
dog(607816) ubiquitin-conjugating enzyme E2H
chicken(416678) ubiquitin-conjugating enzyme E2H
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003344 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003344 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003344 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009459 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009459 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009459 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU093241 MISSION® esiRNA esiRNA targeting mouse Ube2h (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003344 Rosetta Predictions human pricing
NM_182697 Rosetta Predictions human pricing
NM_009459 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335498 predicted 1333
2 SASI_Hs01_00024164 predicted 473
3 SASI_Hs01_00024165 predicted 451
4 SASI_Hs01_00024166 predicted 568
5 SASI_Hs01_00024167 predicted 587
6 SASI_Hs01_00024168 predicted 572
7 SASI_Hs01_00024169 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370862 predicted 1233
2 SASI_Hs01_00104989 predicted 572
3 SASI_Hs01_00104990 predicted 479
4 SASI_Hs01_00104991 predicted 590
5 SASI_Hs01_00104992 predicted 1154
6 SASI_Hs01_00104993 predicted 451
7 SASI_Hs01_00104995 predicted 566
8 SASI_Hs01_00104996 predicted 520
9 SASI_Hs01_00104988 predicted 1154
10 SASI_Hs01_00104994 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161157 predicted 525
2 SASI_Mm01_00161158 predicted 493
3 SASI_Mm01_00161153 predicted 279
4 SASI_Mm01_00161159 predicted 486
5 SASI_Mm01_00161155 predicted 273
6 SASI_Mm01_00161160 predicted 485
7 SASI_Mm01_00161161 predicted 322
8 SASI_Mm02_00316178 predicted 250
9 SASI_Mm02_00316179 predicted 433
10 SASI_Mm02_00316180 predicted 331
11 SASI_Mm01_00161152 predicted 404
12 SASI_Mm01_00161154 predicted 283
13 SASI_Mm01_00161156 predicted 272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003344
VALIDATED
UBE2H MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2H
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003344.2-2013s21c1
Sequence:CCGGCTTCATGTTCTGGTTTGGTTTCTCGAGAAACCAAACCAGAACATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003344.2-538s21c1
Sequence:CCGGCGGAGTATGGAAAGTTAGAGTCTCGAGACTCTAACTTTCCATACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003344.2-440s21c1
Sequence:CCGGGTCAAGCTCATCGAGAGTAAACTCGAGTTTACTCTCGATGAGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003344.2-469s21c1
Sequence:CCGGTACGATCCTGGGAGGACTTAACTCGAGTTAAGTCCTCCCAGGATCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003344.2-591s21c1
Sequence:CCGGCATCTATAGGATTCATGAATACTCGAGTATTCATGAATCCTATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003344.x-561s1c1
Sequence:CCGGACCTACCTGATAAATACCCTTCTCGAGAAGGGTATTTATCAGGTAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003344.x-555s1c1
Sequence:CCGGGAGTGGACCTACCTGATAAATCTCGAGATTTATCAGGTAGGTCCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003344.x-515s1c1
Sequence:CCGGCCACAAGGAACACCATATGAACTCGAGTTCATATGGTGTTCCTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003344.x-538s1c1
Sequence:CCGGCGGAGTATGGAAAGTTAGAGTCTCGAGACTCTAACTTTCCATACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_003344.x-2013s1c1
Sequence:CCGGCTTCATGTTCTGGTTTGGTTTCTCGAGAAACCAAACCAGAACATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003344
VALIDATED
UBE2H MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2H
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003344.2-2013s21c1
Sequence:CCGGCTTCATGTTCTGGTTTGGTTTCTCGAGAAACCAAACCAGAACATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003344.2-538s21c1
Sequence:CCGGCGGAGTATGGAAAGTTAGAGTCTCGAGACTCTAACTTTCCATACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003344.2-440s21c1
Sequence:CCGGGTCAAGCTCATCGAGAGTAAACTCGAGTTTACTCTCGATGAGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003344.2-469s21c1
Sequence:CCGGTACGATCCTGGGAGGACTTAACTCGAGTTAAGTCCTCCCAGGATCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003344.2-591s21c1
Sequence:CCGGCATCTATAGGATTCATGAATACTCGAGTATTCATGAATCCTATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003344.x-561s1c1
Sequence:CCGGACCTACCTGATAAATACCCTTCTCGAGAAGGGTATTTATCAGGTAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003344.x-555s1c1
Sequence:CCGGGAGTGGACCTACCTGATAAATCTCGAGATTTATCAGGTAGGTCCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003344.x-515s1c1
Sequence:CCGGCCACAAGGAACACCATATGAACTCGAGTTCATATGGTGTTCCTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003344.x-538s1c1
Sequence:CCGGCGGAGTATGGAAAGTTAGAGTCTCGAGACTCTAACTTTCCATACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_003344.x-2013s1c1
Sequence:CCGGCTTCATGTTCTGGTTTGGTTTCTCGAGAAACCAAACCAGAACATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003344
VALIDATED
UBE2H MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2H
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003344.2-2013s21c1
Sequence:CCGGCTTCATGTTCTGGTTTGGTTTCTCGAGAAACCAAACCAGAACATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003344.2-538s21c1
Sequence:CCGGCGGAGTATGGAAAGTTAGAGTCTCGAGACTCTAACTTTCCATACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003344.2-440s21c1
Sequence:CCGGGTCAAGCTCATCGAGAGTAAACTCGAGTTTACTCTCGATGAGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003344.2-469s21c1
Sequence:CCGGTACGATCCTGGGAGGACTTAACTCGAGTTAAGTCCTCCCAGGATCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003344.2-591s21c1
Sequence:CCGGCATCTATAGGATTCATGAATACTCGAGTATTCATGAATCCTATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003344.x-561s1c1
Sequence:CCGGACCTACCTGATAAATACCCTTCTCGAGAAGGGTATTTATCAGGTAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003344.x-555s1c1
Sequence:CCGGGAGTGGACCTACCTGATAAATCTCGAGATTTATCAGGTAGGTCCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003344.x-515s1c1
Sequence:CCGGCCACAAGGAACACCATATGAACTCGAGTTCATATGGTGTTCCTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003344.x-538s1c1
Sequence:CCGGCGGAGTATGGAAAGTTAGAGTCTCGAGACTCTAACTTTCCATACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_003344.x-2013s1c1
Sequence:CCGGCTTCATGTTCTGGTTTGGTTTCTCGAGAAACCAAACCAGAACATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009459
VALIDATED
UBE2H MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2H
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009459.2-2507s1c1
Sequence:CCGGGCTTGTTGAAAGGTGGCTTTACTCGAGTAAAGCCACCTTTCAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009459.2-424s1c1
Sequence:CCGGCCCTTTCAAGTCTCCATCTATCTCGAGATAGATGGAGACTTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009459.2-409s1c1
Sequence:CCGGCCTTCCTGATAAATACCCTTTCTCGAGAAAGGGTATTTATCAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009459.2-530s1c1
Sequence:CCGGGCTCTCTATGATCTTACCAATCTCGAGATTGGTAAGATCATAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009459.2-641s1c1
Sequence:CCGGCCAGAAGAGTACAAGCAGAAACTCGAGTTTCTGCTTGTACTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009459
VALIDATED
UBE2H MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2H
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009459.2-2507s1c1
Sequence:CCGGGCTTGTTGAAAGGTGGCTTTACTCGAGTAAAGCCACCTTTCAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009459.2-424s1c1
Sequence:CCGGCCCTTTCAAGTCTCCATCTATCTCGAGATAGATGGAGACTTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009459.2-409s1c1
Sequence:CCGGCCTTCCTGATAAATACCCTTTCTCGAGAAAGGGTATTTATCAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009459.2-530s1c1
Sequence:CCGGGCTCTCTATGATCTTACCAATCTCGAGATTGGTAAGATCATAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009459.2-641s1c1
Sequence:CCGGCCAGAAGAGTACAAGCAGAAACTCGAGTTTCTGCTTGTACTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009459
VALIDATED
UBE2H MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2H
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009459.2-2507s1c1
Sequence:CCGGGCTTGTTGAAAGGTGGCTTTACTCGAGTAAAGCCACCTTTCAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009459.2-424s1c1
Sequence:CCGGCCCTTTCAAGTCTCCATCTATCTCGAGATAGATGGAGACTTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009459.2-409s1c1
Sequence:CCGGCCTTCCTGATAAATACCCTTTCTCGAGAAAGGGTATTTATCAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009459.2-530s1c1
Sequence:CCGGGCTCTCTATGATCTTACCAATCTCGAGATTGGTAAGATCATAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009459.2-641s1c1
Sequence:CCGGCCAGAAGAGTACAAGCAGAAACTCGAGTTTCTGCTTGTACTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks