EMAIL THIS PAGE TO A FRIEND

UBE2I

ubiquitin-conjugating enzyme E2I

Synonyms: C358B7.1 P18 UBC9
UniProtKB ID: P63279, D3DU69, P50550, Q15698, Q59GX1, Q86VB3
Gene ID:
Human(7329) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Four alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(22196) ubiquitin-conjugating enzyme E2I
Rat(25573) ubiquitin-conjugating enzyme E2I
Zebrafish(30622) ubiquitin-conjugating enzyme E2I
domestic cat(101085770) ubiquitin-conjugating enzyme E2I
dog(491332) ubiquitin-conjugating enzyme E2I
chicken(374123) ubiquitin-conjugating enzyme E2I
naked mole-rat(101713717) ubiquitin-conjugating enzyme E2I
domestic guinea pig(100722207) ubiquitin-conjugating enzyme E2I
cow(515573) ubiquitin-conjugating enzyme E2I
143 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011665 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011665 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011665 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003345 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU092131 MISSION® esiRNA esiRNA targeting mouse Ube2i (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003345 Rosetta Predictions human pricing
NM_194259 Rosetta Predictions human pricing
NM_194260 Rosetta Predictions human pricing
NM_194261 Rosetta Predictions human pricing
NM_013050 Rosetta Predictions rat pricing
NM_011665 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335499 predicted 666
2 SASI_Hs01_00124119 predicted 961
3 SASI_Hs01_00124120 predicted 478
4 SASI_Hs02_00335500 predicted 649
5 SASI_Hs01_00124121 predicted 793
6 SASI_Hs01_00124122 predicted 470
7 SASI_Hs01_00124123 predicted 606
8 SASI_Hs01_00124124 predicted 460
9 SASI_Hs01_00124125 predicted 411
10 SASI_Hs01_00124126 predicted 381
11 SASI_Hs01_00124127 predicted 790
12 SASI_Hs01_00124128 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371377 predicted 914
2 SASI_Hs01_00203134 predicted 1216
3 SASI_Hs01_00203135 predicted 737
4 SASI_Hs02_00371378 predicted 900
5 SASI_Hs01_00203136 predicted 1048
6 SASI_Hs01_00203137 predicted 722
7 SASI_Hs01_00203138 predicted 858
8 SASI_Hs01_00203139 predicted 717
9 SASI_Hs01_00203140 predicted 671
10 SASI_Hs01_00203141 predicted 640
11 SASI_Hs01_00203142 predicted 1042
12 SASI_Hs01_00203143 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371379 predicted 582
2 SASI_Hs01_00240092 predicted 881
3 SASI_Hs01_00240093 predicted 397
4 SASI_Hs02_00371380 predicted 569
5 SASI_Hs01_00240094 predicted 720
6 SASI_Hs01_00240095 predicted 396
7 SASI_Hs01_00240096 predicted 523
8 SASI_Hs01_00240097 predicted 383
9 SASI_Hs01_00240098 predicted 335
10 SASI_Hs01_00240099 predicted 303
11 SASI_Hs01_00240100 predicted 709
12 SASI_Hs01_00240101 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371381 predicted 614
2 SASI_Hs01_00232217 predicted 916
3 SASI_Hs01_00232218 predicted 438
4 SASI_Hs02_00371382 predicted 602
5 SASI_Hs01_00232219 predicted 744
6 SASI_Hs01_00232220 predicted 425
7 SASI_Hs01_00232221 predicted 558
8 SASI_Hs01_00232222 predicted 413
9 SASI_Hs01_00232223 predicted 369
10 SASI_Hs01_00232224 predicted 337
11 SASI_Hs01_00232225 predicted 746
12 SASI_Hs01_00232226 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013050 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260776 predicted 274
2 SASI_Rn02_00260777 predicted 459
3 SASI_Rn02_00260778 predicted 430
4 SASI_Rn02_00260779 predicted 415
5 SASI_Rn02_00260780 predicted 310
6 SASI_Rn02_00260781 predicted 395
7 SASI_Rn02_00260782 predicted 457
8 SASI_Rn02_00260783 predicted 429
9 SASI_Rn02_00260784 predicted 312
10 SASI_Rn02_00260785 predicted 323
11 SASI_Rn01_00043057 predicted 173
12 SASI_Rn01_00043058 predicted 146
13 SASI_Rn01_00043059 predicted 180
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011665 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201296 predicted 457
2 SASI_Mm01_00201298 predicted 332
3 SASI_Mm02_00321174 predicted 1038
4 SASI_Mm01_00201301 predicted 907
5 SASI_Mm01_00201303 predicted 472
6 SASI_Mm01_00201304 predicted 451
7 SASI_Mm02_00321175 predicted 233
8 SASI_Mm01_00201305 predicted 1021
9 SASI_Mm02_00321176 predicted 445
10 SASI_Mm02_00321177 predicted 452
11 SASI_Mm01_00201297 predicted 1086
12 SASI_Mm01_00201299 predicted 448
13 SASI_Mm01_00201300 predicted 526
14 SASI_Mm01_00201302 predicted 500
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011665
VALIDATED
UBE2I MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2I
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011665.2-2328s1c1
Sequence:CCGGCCAGCTATGAAGTGTTCCTTTCTCGAGAAAGGAACACTTCATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011665.2-539s1c1
Sequence:CCGGGCCTACACAATTTACTGCCAACTCGAGTTGGCAGTAAATTGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011665.2-452s1c1
Sequence:CCGGAGGCCAGCTATCACCATCAAACTCGAGTTTGATGGTGATAGCTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011665.2-312s1c1
Sequence:CCGGTGTTCAAGCTACGGATGCTTTCTCGAGAAAGCATCCGTAGCTTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011665.2-241s1c1
Sequence:CCGGTGGCACAATGAACCTGATGAACTCGAGTTCATCAGGTTCATTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011665.3-451s21c1
Sequence:CCGGAGGCCAGCTATCACCATCAAACTCGAGTTTGATGGTGATAGCTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011665.3-311s21c1
Sequence:CCGGTGTTCAAGCTACGGATGCTTTCTCGAGAAAGCATCCGTAGCTTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011665.3-538s21c1
Sequence:CCGGGCCTACACAATTTACTGCCAACTCGAGTTGGCAGTAAATTGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011665.3-240s21c1
Sequence:CCGGTGGCACAATGAACCTGATGAACTCGAGTTCATCAGGTTCATTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011665
VALIDATED
UBE2I MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2I
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011665.2-2328s1c1
Sequence:CCGGCCAGCTATGAAGTGTTCCTTTCTCGAGAAAGGAACACTTCATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011665.2-539s1c1
Sequence:CCGGGCCTACACAATTTACTGCCAACTCGAGTTGGCAGTAAATTGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011665.2-452s1c1
Sequence:CCGGAGGCCAGCTATCACCATCAAACTCGAGTTTGATGGTGATAGCTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011665.2-312s1c1
Sequence:CCGGTGTTCAAGCTACGGATGCTTTCTCGAGAAAGCATCCGTAGCTTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011665.2-241s1c1
Sequence:CCGGTGGCACAATGAACCTGATGAACTCGAGTTCATCAGGTTCATTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011665.3-451s21c1
Sequence:CCGGAGGCCAGCTATCACCATCAAACTCGAGTTTGATGGTGATAGCTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011665.3-311s21c1
Sequence:CCGGTGTTCAAGCTACGGATGCTTTCTCGAGAAAGCATCCGTAGCTTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011665.3-538s21c1
Sequence:CCGGGCCTACACAATTTACTGCCAACTCGAGTTGGCAGTAAATTGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011665.3-240s21c1
Sequence:CCGGTGGCACAATGAACCTGATGAACTCGAGTTCATCAGGTTCATTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011665
VALIDATED
UBE2I MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2I
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011665.2-2328s1c1
Sequence:CCGGCCAGCTATGAAGTGTTCCTTTCTCGAGAAAGGAACACTTCATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011665.2-539s1c1
Sequence:CCGGGCCTACACAATTTACTGCCAACTCGAGTTGGCAGTAAATTGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011665.2-452s1c1
Sequence:CCGGAGGCCAGCTATCACCATCAAACTCGAGTTTGATGGTGATAGCTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011665.2-312s1c1
Sequence:CCGGTGTTCAAGCTACGGATGCTTTCTCGAGAAAGCATCCGTAGCTTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011665.2-241s1c1
Sequence:CCGGTGGCACAATGAACCTGATGAACTCGAGTTCATCAGGTTCATTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011665.3-451s21c1
Sequence:CCGGAGGCCAGCTATCACCATCAAACTCGAGTTTGATGGTGATAGCTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011665.3-311s21c1
Sequence:CCGGTGTTCAAGCTACGGATGCTTTCTCGAGAAAGCATCCGTAGCTTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011665.3-538s21c1
Sequence:CCGGGCCTACACAATTTACTGCCAACTCGAGTTGGCAGTAAATTGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011665.3-240s21c1
Sequence:CCGGTGGCACAATGAACCTGATGAACTCGAGTTCATCAGGTTCATTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003345
VALIDATED
UBE2I MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2I
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003345.3-545s1c1
Sequence:CCGGGCCTACACGATTTACTGCCAACTCGAGTTGGCAGTAAATCGTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003345.3-194s1c1
Sequence:CCGGTGGAGGAAAGACCACCCATTTCTCGAGAAATGGGTGGTCTTTCCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003345.3-693s1c1
Sequence:CCGGGCAAATCTAAAGTTGCTCCATCTCGAGATGGAGCAACTTTAGATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003345.3-603s1c1
Sequence:CCGGCCAAGAAGTTTGCGCCCTCATCTCGAGATGAGGGCGCAAACTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003345.3-606s21c1
Sequence:CCGGAGAAGTTTGCGCCCTCATAAGCTCGAGCTTATGAGGGCGCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003345.3-538s21c1
Sequence:CCGGAGCAGAGGCCTACACGATTTACTCGAGTAAATCGTGTAGGCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003345.3-470s21c1
Sequence:CCGGACAATCAAACAGATCCTATTACTCGAGTAATAGGATCTGTTTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003345.3-373s21c1
Sequence:CCGGTAAATTCGAACCACCATTATTCTCGAGAATAATGGTGGTTCGAATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003345.3-693s21c1
Sequence:CCGGGCAAATCTAAAGTTGCTCCATCTCGAGATGGAGCAACTTTAGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003345.3-500s21c1
Sequence:CCGGGAACTTCTAAATGAACCAAATCTCGAGATTTGGTTCATTTAGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003345
VALIDATED
UBE2I MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2I
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003345.3-545s1c1
Sequence:CCGGGCCTACACGATTTACTGCCAACTCGAGTTGGCAGTAAATCGTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003345.3-194s1c1
Sequence:CCGGTGGAGGAAAGACCACCCATTTCTCGAGAAATGGGTGGTCTTTCCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003345.3-693s1c1
Sequence:CCGGGCAAATCTAAAGTTGCTCCATCTCGAGATGGAGCAACTTTAGATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003345.3-603s1c1
Sequence:CCGGCCAAGAAGTTTGCGCCCTCATCTCGAGATGAGGGCGCAAACTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003345.3-606s21c1
Sequence:CCGGAGAAGTTTGCGCCCTCATAAGCTCGAGCTTATGAGGGCGCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003345.3-538s21c1
Sequence:CCGGAGCAGAGGCCTACACGATTTACTCGAGTAAATCGTGTAGGCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003345.3-470s21c1
Sequence:CCGGACAATCAAACAGATCCTATTACTCGAGTAATAGGATCTGTTTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003345.3-373s21c1
Sequence:CCGGTAAATTCGAACCACCATTATTCTCGAGAATAATGGTGGTTCGAATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003345.3-693s21c1
Sequence:CCGGGCAAATCTAAAGTTGCTCCATCTCGAGATGGAGCAACTTTAGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003345.3-500s21c1
Sequence:CCGGGAACTTCTAAATGAACCAAATCTCGAGATTTGGTTCATTTAGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003345
VALIDATED
UBE2I MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2I
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003345.3-545s1c1
Sequence:CCGGGCCTACACGATTTACTGCCAACTCGAGTTGGCAGTAAATCGTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003345.3-194s1c1
Sequence:CCGGTGGAGGAAAGACCACCCATTTCTCGAGAAATGGGTGGTCTTTCCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003345.3-693s1c1
Sequence:CCGGGCAAATCTAAAGTTGCTCCATCTCGAGATGGAGCAACTTTAGATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003345.3-603s1c1
Sequence:CCGGCCAAGAAGTTTGCGCCCTCATCTCGAGATGAGGGCGCAAACTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003345.3-606s21c1
Sequence:CCGGAGAAGTTTGCGCCCTCATAAGCTCGAGCTTATGAGGGCGCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003345.3-538s21c1
Sequence:CCGGAGCAGAGGCCTACACGATTTACTCGAGTAAATCGTGTAGGCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003345.3-470s21c1
Sequence:CCGGACAATCAAACAGATCCTATTACTCGAGTAATAGGATCTGTTTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003345.3-373s21c1
Sequence:CCGGTAAATTCGAACCACCATTATTCTCGAGAATAATGGTGGTTCGAATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003345.3-693s21c1
Sequence:CCGGGCAAATCTAAAGTTGCTCCATCTCGAGATGGAGCAACTTTAGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003345.3-500s21c1
Sequence:CCGGGAACTTCTAAATGAACCAAATCTCGAGATTTGGTTCATTTAGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks