EMAIL THIS PAGE TO A FRIEND

UBE2J1

ubiquitin-conjugating enzyme E2, J1

Synonyms: HSPC153 HSPC205 HSU93243 NCUBE-1 NCUBE1 UBC6 Ubc6p
Gene ID:
Human(51465) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is located in the membrane of the endoplasmic reticulum (ER) and may contribute to quality control ER-associated degradation by the ubiquitin-proteasome system. [provided by RefSeq, Jul 2008]
Mouse(56228) ubiquitin-conjugating enzyme E2J 1
Rat(297961) ubiquitin-conjugating enzyme E2, J1
Zebrafish(406794) ubiquitin-conjugating enzyme E2, J1
chicken(395528) ubiquitin-conjugating enzyme E2, J1
domestic cat(101093860) ubiquitin-conjugating enzyme E2, J1
dog(474993) ubiquitin-conjugating enzyme E2, J1
cow(539754) ubiquitin-conjugating enzyme E2, J1, U
sheep(101110601) ubiquitin-conjugating enzyme E2, J1
domestic guinea pig(100729250) ubiquitin-conjugating enzyme E2, J1
naked mole-rat(101723415) ubiquitin-conjugating enzyme E2, J1
204 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016021 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016021 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016021 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019586 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019586 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019586 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016021 Rosetta Predictions human pricing
NM_001106642 Rosetta Predictions rat pricing
NM_019586 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027696 predicted 887
2 SASI_Hs01_00027697 predicted 424
3 SASI_Hs01_00027698 predicted 1300
4 SASI_Hs01_00027699 predicted 1117
5 SASI_Hs01_00027700 predicted 850
6 SASI_Hs02_00348705 predicted 1116
7 SASI_Hs01_00027701 predicted 864
8 SASI_Hs01_00027702 predicted 924
9 SASI_Hs01_00027703 predicted 1270
10 SASI_Hs01_00027704 predicted 1225
11 SASI_Hs01_00027705 predicted 1259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106642 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220958 predicted 553
2 SASI_Rn02_00220959 predicted 613
3 SASI_Rn02_00220960 predicted 261
4 SASI_Rn02_00220961 predicted 644
5 SASI_Rn02_00220962 predicted 586
6 SASI_Rn02_00220963 predicted 617
7 SASI_Rn02_00220964 predicted 332
8 SASI_Rn02_00220965 predicted 659
9 SASI_Rn02_00220966 predicted 444
10 SASI_Rn02_00220967 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121291 predicted 591
2 SASI_Mm01_00121292 predicted 1077
3 SASI_Mm01_00121293 predicted 751
4 SASI_Mm01_00121294 predicted 1168
5 SASI_Mm01_00121295 predicted 1203
6 SASI_Mm01_00121296 predicted 1096
7 SASI_Mm01_00121297 predicted 1057
8 SASI_Mm01_00121298 predicted 559
9 SASI_Mm01_00121299 predicted 405
10 SASI_Mm01_00121300 predicted 777
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016021
VALIDATED
UBE2J1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2, J1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016021.2-358s21c1
Sequence:CCGGTCCGGCTGTTAAACGTTTAATCTCGAGATTAAACGTTTAACAGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016021.2-965s21c1
Sequence:CCGGGATGATATACCTACAACATTCCTCGAGGAATGTTGTAGGTATATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016021.2-1333s21c1
Sequence:CCGGACATTCTGCATTGGGTATAATCTCGAGATTATACCCAATGCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016021.2-1227s21c1
Sequence:CCGGCAGCTCTTATATTCCGACGAACTCGAGTTCGTCGGAATATAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016021.2-545s21c1
Sequence:CCGGCCACCAAGCATTATTCTCCTACTCGAGTAGGAGAATAATGCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016021.x-1227s1c1
Sequence:CCGGCAGCTCTTATATTCCGACGAACTCGAGTTCGTCGGAATATAAGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016021.x-1160s1c1
Sequence:CCGGCCAAGAGACAACCACACTGATCTCGAGATCAGTGTGGTTGTCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016021.x-645s1c1
Sequence:CCGGCGTGGAGTATAAGGACAGCATCTCGAGATGCTGTCCTTATACTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004131    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016021.x-3152s1c1
Sequence:CCGGGCTGAGATTGTGTGCTAGGAACTCGAGTTCCTAGCACACAATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016021.x-545s1c1
Sequence:CCGGCCACCAAGCATTATTCTCCTACTCGAGTAGGAGAATAATGCTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016021
VALIDATED
UBE2J1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2, J1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016021.2-358s21c1
Sequence:CCGGTCCGGCTGTTAAACGTTTAATCTCGAGATTAAACGTTTAACAGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016021.2-965s21c1
Sequence:CCGGGATGATATACCTACAACATTCCTCGAGGAATGTTGTAGGTATATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016021.2-1333s21c1
Sequence:CCGGACATTCTGCATTGGGTATAATCTCGAGATTATACCCAATGCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016021.2-1227s21c1
Sequence:CCGGCAGCTCTTATATTCCGACGAACTCGAGTTCGTCGGAATATAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016021.2-545s21c1
Sequence:CCGGCCACCAAGCATTATTCTCCTACTCGAGTAGGAGAATAATGCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016021.x-1227s1c1
Sequence:CCGGCAGCTCTTATATTCCGACGAACTCGAGTTCGTCGGAATATAAGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016021.x-1160s1c1
Sequence:CCGGCCAAGAGACAACCACACTGATCTCGAGATCAGTGTGGTTGTCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016021.x-645s1c1
Sequence:CCGGCGTGGAGTATAAGGACAGCATCTCGAGATGCTGTCCTTATACTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004131    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016021.x-3152s1c1
Sequence:CCGGGCTGAGATTGTGTGCTAGGAACTCGAGTTCCTAGCACACAATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016021.x-545s1c1
Sequence:CCGGCCACCAAGCATTATTCTCCTACTCGAGTAGGAGAATAATGCTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016021
VALIDATED
UBE2J1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2, J1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016021.2-358s21c1
Sequence:CCGGTCCGGCTGTTAAACGTTTAATCTCGAGATTAAACGTTTAACAGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016021.2-965s21c1
Sequence:CCGGGATGATATACCTACAACATTCCTCGAGGAATGTTGTAGGTATATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016021.2-1333s21c1
Sequence:CCGGACATTCTGCATTGGGTATAATCTCGAGATTATACCCAATGCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016021.2-1227s21c1
Sequence:CCGGCAGCTCTTATATTCCGACGAACTCGAGTTCGTCGGAATATAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_016021.2-545s21c1
Sequence:CCGGCCACCAAGCATTATTCTCCTACTCGAGTAGGAGAATAATGCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016021.x-1227s1c1
Sequence:CCGGCAGCTCTTATATTCCGACGAACTCGAGTTCGTCGGAATATAAGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016021.x-1160s1c1
Sequence:CCGGCCAAGAGACAACCACACTGATCTCGAGATCAGTGTGGTTGTCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016021.x-645s1c1
Sequence:CCGGCGTGGAGTATAAGGACAGCATCTCGAGATGCTGTCCTTATACTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004131    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016021.x-3152s1c1
Sequence:CCGGGCTGAGATTGTGTGCTAGGAACTCGAGTTCCTAGCACACAATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016021.x-545s1c1
Sequence:CCGGCCACCAAGCATTATTCTCCTACTCGAGTAGGAGAATAATGCTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019586
VALIDATED
UBE2J1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2, J1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019586.3-1139s21c1
Sequence:CCGGGCTGTGACTCAGTTGCTTCATCTCGAGATGAAGCAACTGAGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019586.3-1059s21c1
Sequence:CCGGGCTCTTATATTCCGACGAATACTCGAGTATTCGTCGGAATATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019586.3-367s21c1
Sequence:CCGGCCATGAAACCACCAAGCATTACTCGAGTAATGCTTGGTGGTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019586.3-507s21c1
Sequence:CCGGATCGGGTTTATGCCGACTAAACTCGAGTTTAGTCGGCATAAACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019586.2-959s1c1
Sequence:CCGGCGACGAATATATCTGGCCAATCTCGAGATTGGCCAGATATATTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019586.2-280s1c1
Sequence:CCGGGCTAACAGCTAATGGACGATTCTCGAGAATCGTCCATTAGCTGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019586.2-255s1c1
Sequence:CCGGCCATGAAACCACCAAGCATTACTCGAGTAATGCTTGGTGGTTTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019586.2-1027s1c1
Sequence:CCGGGCTGTGACTCAGTTGCTTCATCTCGAGATGAAGCAACTGAGTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019586.2-947s1c1
Sequence:CCGGGCTCTTATATTCCGACGAATACTCGAGTATTCGTCGGAATATAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019586
VALIDATED
UBE2J1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2, J1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019586.3-1139s21c1
Sequence:CCGGGCTGTGACTCAGTTGCTTCATCTCGAGATGAAGCAACTGAGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019586.3-1059s21c1
Sequence:CCGGGCTCTTATATTCCGACGAATACTCGAGTATTCGTCGGAATATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019586.3-367s21c1
Sequence:CCGGCCATGAAACCACCAAGCATTACTCGAGTAATGCTTGGTGGTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019586.3-507s21c1
Sequence:CCGGATCGGGTTTATGCCGACTAAACTCGAGTTTAGTCGGCATAAACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019586.2-959s1c1
Sequence:CCGGCGACGAATATATCTGGCCAATCTCGAGATTGGCCAGATATATTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019586.2-280s1c1
Sequence:CCGGGCTAACAGCTAATGGACGATTCTCGAGAATCGTCCATTAGCTGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019586.2-255s1c1
Sequence:CCGGCCATGAAACCACCAAGCATTACTCGAGTAATGCTTGGTGGTTTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019586.2-1027s1c1
Sequence:CCGGGCTGTGACTCAGTTGCTTCATCTCGAGATGAAGCAACTGAGTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019586.2-947s1c1
Sequence:CCGGGCTCTTATATTCCGACGAATACTCGAGTATTCGTCGGAATATAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019586
VALIDATED
UBE2J1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2, J1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019586.3-1139s21c1
Sequence:CCGGGCTGTGACTCAGTTGCTTCATCTCGAGATGAAGCAACTGAGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019586.3-1059s21c1
Sequence:CCGGGCTCTTATATTCCGACGAATACTCGAGTATTCGTCGGAATATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019586.3-367s21c1
Sequence:CCGGCCATGAAACCACCAAGCATTACTCGAGTAATGCTTGGTGGTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019586.3-507s21c1
Sequence:CCGGATCGGGTTTATGCCGACTAAACTCGAGTTTAGTCGGCATAAACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019586.2-959s1c1
Sequence:CCGGCGACGAATATATCTGGCCAATCTCGAGATTGGCCAGATATATTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019586.2-280s1c1
Sequence:CCGGGCTAACAGCTAATGGACGATTCTCGAGAATCGTCCATTAGCTGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019586.2-255s1c1
Sequence:CCGGCCATGAAACCACCAAGCATTACTCGAGTAATGCTTGGTGGTTTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019586.2-1027s1c1
Sequence:CCGGGCTGTGACTCAGTTGCTTCATCTCGAGATGAAGCAACTGAGTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019586.2-947s1c1
Sequence:CCGGGCTCTTATATTCCGACGAATACTCGAGTATTCGTCGGAATATAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks