EMAIL THIS PAGE TO A FRIEND

UBE2J2

ubiquitin-conjugating enzyme E2, J2

Synonyms: NCUBE-2 NCUBE2 PRO2121
UniProtKB ID: Q8N2K1, A8MYC7, Q504T9, Q96N26, Q96T84
Gene ID:
Human(118424) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is located in the membrane of the endoplasmic reticulum. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
Mouse(140499) ubiquitin-conjugating enzyme E2J 2
Rat(298689) ubiquitin-conjugating enzyme E2, J2
naked mole-rat(101720519) ubiquitin-conjugating enzyme E2, J2
domestic guinea pig(100730229) ubiquitin-conjugating enzyme E2, J2
cow(506103) ubiquitin-conjugating enzyme E2, J2
sheep(101107977) ubiquitin-conjugating enzyme E2, J2
Zebrafish(100037384) ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast)
domestic cat(101101628) ubiquitin-conjugating enzyme E2, J2
Horse(100067387) ubiquitin-conjugating enzyme E2, J2
dog(606935) ubiquitin-conjugating enzyme E2, J2
chicken(419421) ubiquitin-conjugating enzyme E2, J2
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_058167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058167 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123311 MISSION® esiRNA esiRNA human UBE2J2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_058167 Rosetta Predictions human pricing
NM_194315 Rosetta Predictions human pricing
NM_194457 Rosetta Predictions human pricing
NM_194458 Rosetta Predictions human pricing
NM_001007655 Rosetta Predictions rat pricing
NM_001039157 Rosetta Predictions mouse pricing
NM_001039158 Rosetta Predictions mouse pricing
NM_001039159 Rosetta Predictions mouse pricing
NM_021402 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095058 predicted 908
2 SASI_Hs01_00095059 predicted 576
3 SASI_Hs01_00095060 predicted 664
4 SASI_Hs01_00095061 predicted 1221
5 SASI_Hs01_00095062 predicted 669
6 SASI_Hs01_00095063 predicted 1277
7 SASI_Hs01_00095064 predicted 901
8 SASI_Hs01_00095065 predicted 1274
9 SASI_Hs01_00095066 predicted 621
10 SASI_Hs01_00095067 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056565 predicted 955
2 SASI_Hs01_00056566 predicted 629
3 SASI_Hs01_00056567 predicted 710
4 SASI_Hs01_00056568 predicted 1274
5 SASI_Hs01_00056569 predicted 720
6 SASI_Hs01_00056570 predicted 1325
7 SASI_Hs01_00056571 predicted 951
8 SASI_Hs01_00056572 predicted 1329
9 SASI_Hs01_00056573 predicted 667
10 SASI_Hs01_00056574 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227779 predicted 771
2 SASI_Hs01_00227780 predicted 448
3 SASI_Hs01_00227781 predicted 539
4 SASI_Hs01_00227782 predicted 1092
5 SASI_Hs01_00227783 predicted 532
6 SASI_Hs01_00227784 predicted 1140
7 SASI_Hs01_00227785 predicted 770
8 SASI_Hs01_00227786 predicted 1148
9 SASI_Hs01_00227787 predicted 494
10 SASI_Hs01_00227788 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071423 predicted 1032
2 SASI_Hs01_00071424 predicted 712
3 SASI_Hs01_00071425 predicted 794
4 SASI_Hs01_00071426 predicted 1353
5 SASI_Hs01_00071427 predicted 801
6 SASI_Hs01_00071428 predicted 1397
7 SASI_Hs01_00071429 predicted 1029
8 SASI_Hs01_00071430 predicted 1403
9 SASI_Hs01_00071431 predicted 751
10 SASI_Hs01_00071432 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115406 predicted 693
2 SASI_Rn01_00115407 predicted 527
3 SASI_Rn01_00115408 predicted 1005
4 SASI_Rn01_00115409 predicted 999
5 SASI_Rn01_00115410 predicted 506
6 SASI_Rn01_00115411 predicted 696
7 SASI_Rn01_00115412 predicted 882
8 SASI_Rn01_00115414 predicted 1181
9 SASI_Rn01_00115415 predicted 710
10 SASI_Rn02_00198779 predicted 539
11 SASI_Rn01_00115413 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039157 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289879 predicted 554
2 SASI_Mm02_00289880 predicted 855
3 SASI_Mm02_00289881 predicted 619
4 SASI_Mm02_00289882 predicted 767
5 SASI_Mm02_00289883 predicted 570
6 SASI_Mm02_00289884 predicted 1091
7 SASI_Mm02_00289885 predicted 539
8 SASI_Mm02_00289886 predicted 1137
9 SASI_Mm02_00289887 predicted 1066
10 SASI_Mm02_00289888 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039158 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289889 predicted 526
2 SASI_Mm02_00289890 predicted 831
3 SASI_Mm02_00289891 predicted 595
4 SASI_Mm02_00289892 predicted 745
5 SASI_Mm02_00289893 predicted 542
6 SASI_Mm02_00289894 predicted 1064
7 SASI_Mm02_00289895 predicted 518
8 SASI_Mm02_00289896 predicted 1120
9 SASI_Mm02_00289897 predicted 1040
10 SASI_Mm02_00289898 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039159 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289899 predicted 394
2 SASI_Mm02_00289900 predicted 692
3 SASI_Mm02_00289901 predicted 452
4 SASI_Mm02_00289902 predicted 607
5 SASI_Mm02_00289903 predicted 399
6 SASI_Mm02_00289904 predicted 926
7 SASI_Mm02_00289905 predicted 380
8 SASI_Mm02_00289906 predicted 979
9 SASI_Mm02_00289907 predicted 900
10 SASI_Mm02_00289908 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326019 predicted 690
2 SASI_Mm02_00326020 predicted 999
3 SASI_Mm02_00326021 predicted 753
4 SASI_Mm02_00326022 predicted 903
5 SASI_Mm02_00326023 predicted 699
6 SASI_Mm02_00326024 predicted 1226
7 SASI_Mm02_00326025 predicted 682
8 SASI_Mm02_00326026 predicted 1278
9 SASI_Mm02_00326027 predicted 1204
10 SASI_Mm02_00326028 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058167
UBE2J2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2, J2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058167.2-673s1c1
Sequence:CCGGGAAGTCGTGGAGGAGATTAAACTCGAGTTTAATCTCCTCCACGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034084    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_058167.2-2138s1c1
Sequence:CCGGCGCGCTCATCTTTCTTCGTTTCTCGAGAAACGAAGAAAGATGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058167.2-408s1c1
Sequence:CCGGCAAACCTCCCAGTATCTATATCTCGAGATATAGATACTGGGAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034088    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_058167.2-256s1c1
Sequence:CCGGCGCATTAAGAAAGACCCGGTGCTCGAGCACCGGGTCTTTCTTAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058167.2-358s1c1
Sequence:CCGGGAAGGTGGCTATTATCATGGACTCGAGTCCATGATAATAGCCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058167.2-1273s21c1
Sequence:CCGGTAGATGTGGTCACTTAGAAATCTCGAGATTTCTAAGTGACCACATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058167.2-468s21c1
Sequence:CCGGGTGTCTTTCTATCACGGATTTCTCGAGAAATCCGTGATAGAAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058167
UBE2J2 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2, J2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058167.2-673s1c1
Sequence:CCGGGAAGTCGTGGAGGAGATTAAACTCGAGTTTAATCTCCTCCACGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034084    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_058167.2-2138s1c1
Sequence:CCGGCGCGCTCATCTTTCTTCGTTTCTCGAGAAACGAAGAAAGATGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058167.2-408s1c1
Sequence:CCGGCAAACCTCCCAGTATCTATATCTCGAGATATAGATACTGGGAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034088    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_058167.2-256s1c1
Sequence:CCGGCGCATTAAGAAAGACCCGGTGCTCGAGCACCGGGTCTTTCTTAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058167.2-358s1c1
Sequence:CCGGGAAGGTGGCTATTATCATGGACTCGAGTCCATGATAATAGCCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058167.2-1273s21c1
Sequence:CCGGTAGATGTGGTCACTTAGAAATCTCGAGATTTCTAAGTGACCACATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058167.2-468s21c1
Sequence:CCGGGTGTCTTTCTATCACGGATTTCTCGAGAAATCCGTGATAGAAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058167
UBE2J2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2, J2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058167.2-673s1c1
Sequence:CCGGGAAGTCGTGGAGGAGATTAAACTCGAGTTTAATCTCCTCCACGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034084    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_058167.2-2138s1c1
Sequence:CCGGCGCGCTCATCTTTCTTCGTTTCTCGAGAAACGAAGAAAGATGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058167.2-408s1c1
Sequence:CCGGCAAACCTCCCAGTATCTATATCTCGAGATATAGATACTGGGAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034088    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_058167.2-256s1c1
Sequence:CCGGCGCATTAAGAAAGACCCGGTGCTCGAGCACCGGGTCTTTCTTAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058167.2-358s1c1
Sequence:CCGGGAAGGTGGCTATTATCATGGACTCGAGTCCATGATAATAGCCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058167.2-1273s21c1
Sequence:CCGGTAGATGTGGTCACTTAGAAATCTCGAGATTTCTAAGTGACCACATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058167.2-468s21c1
Sequence:CCGGGTGTCTTTCTATCACGGATTTCTCGAGAAATCCGTGATAGAAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021402
VALIDATED
UBE2J2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2, J2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021402.4-629s1c1
Sequence:CCGGCCTTATGAAGGTGGCTATTATCTCGAGATAATAGCCACCTTCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021402.4-1166s1c1
Sequence:CCGGGCGAACTTGTTGGTTATAGTTCTCGAGAACTATAACCAACAAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021402.4-508s1c1
Sequence:CCGGACAAAGGTTGAAGCAGGACTACTCGAGTAGTCCTGCTTCAACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021402.4-756s1c1
Sequence:CCGGTCACAGATTTCCACCCAGATACTCGAGTATCTGGGTGGAAATCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021402.4-720s1c1
Sequence:CCGGGAAGATTTAAGTGCAACACAACTCGAGTTGTGTTGCACTTAAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021402.5-1676s21c1
Sequence:CCGGGGTCTAGGAGAGGACTGATTTCTCGAGAAATCAGTCCTCTCCTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021402.5-537s21c1
Sequence:CCGGGCAGGACTACCTTCGAATTAACTCGAGTTAATTCGAAGGTAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021402.5-474s21c1
Sequence:CCGGTGCCAGAAAGATGAGCAATAACTCGAGTTATTGCTCATCTTTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021402.5-699s21c1
Sequence:CCGGATTTAAGCCTCCTAGTATTTACTCGAGTAAATACTAGGAGGCTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021402.5-645s21c1
Sequence:CCGGTCCTTATGAAGGTGGCTATTACTCGAGTAATAGCCACCTTCATAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021402
VALIDATED
UBE2J2 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2, J2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021402.4-629s1c1
Sequence:CCGGCCTTATGAAGGTGGCTATTATCTCGAGATAATAGCCACCTTCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021402.4-1166s1c1
Sequence:CCGGGCGAACTTGTTGGTTATAGTTCTCGAGAACTATAACCAACAAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021402.4-508s1c1
Sequence:CCGGACAAAGGTTGAAGCAGGACTACTCGAGTAGTCCTGCTTCAACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021402.4-756s1c1
Sequence:CCGGTCACAGATTTCCACCCAGATACTCGAGTATCTGGGTGGAAATCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021402.4-720s1c1
Sequence:CCGGGAAGATTTAAGTGCAACACAACTCGAGTTGTGTTGCACTTAAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021402.5-1676s21c1
Sequence:CCGGGGTCTAGGAGAGGACTGATTTCTCGAGAAATCAGTCCTCTCCTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021402.5-537s21c1
Sequence:CCGGGCAGGACTACCTTCGAATTAACTCGAGTTAATTCGAAGGTAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021402.5-474s21c1
Sequence:CCGGTGCCAGAAAGATGAGCAATAACTCGAGTTATTGCTCATCTTTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021402.5-699s21c1
Sequence:CCGGATTTAAGCCTCCTAGTATTTACTCGAGTAAATACTAGGAGGCTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021402.5-645s21c1
Sequence:CCGGTCCTTATGAAGGTGGCTATTACTCGAGTAATAGCCACCTTCATAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021402
VALIDATED
UBE2J2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2, J2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021402.4-629s1c1
Sequence:CCGGCCTTATGAAGGTGGCTATTATCTCGAGATAATAGCCACCTTCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021402.4-1166s1c1
Sequence:CCGGGCGAACTTGTTGGTTATAGTTCTCGAGAACTATAACCAACAAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021402.4-508s1c1
Sequence:CCGGACAAAGGTTGAAGCAGGACTACTCGAGTAGTCCTGCTTCAACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021402.4-756s1c1
Sequence:CCGGTCACAGATTTCCACCCAGATACTCGAGTATCTGGGTGGAAATCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021402.4-720s1c1
Sequence:CCGGGAAGATTTAAGTGCAACACAACTCGAGTTGTGTTGCACTTAAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021402.5-1676s21c1
Sequence:CCGGGGTCTAGGAGAGGACTGATTTCTCGAGAAATCAGTCCTCTCCTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021402.5-537s21c1
Sequence:CCGGGCAGGACTACCTTCGAATTAACTCGAGTTAATTCGAAGGTAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021402.5-474s21c1
Sequence:CCGGTGCCAGAAAGATGAGCAATAACTCGAGTTATTGCTCATCTTTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021402.5-699s21c1
Sequence:CCGGATTTAAGCCTCCTAGTATTTACTCGAGTAAATACTAGGAGGCTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021402.5-645s21c1
Sequence:CCGGTCCTTATGAAGGTGGCTATTACTCGAGTAATAGCCACCTTCATAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks