EMAIL THIS PAGE TO A FRIEND

UBE2K

ubiquitin-conjugating enzyme E2K

Synonyms: E2-25K HIP2 HYPG LIG UBC1
Gene ID:
Human(3093) Summary: The protein encoded by this gene belongs to the ubiquitin-conjugating enzyme family. This protein interacts with RING finger proteins, and it can ubiquitinate huntingtin, the gene product for Huntington's disease. Known functions for this protein include a role in aggregate formation of expanded polyglutamine proteins and the suppression of apoptosis in polyglutamine diseases, a role in the dislocation of newly synthesized MHC class I heavy chains from the endoplasmic reticulum, and involvement in foam cell formation. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(53323) ubiquitin-conjugating enzyme E2K
Rat(289623) ubiquitin-conjugating enzyme E2K
chicken(428787) ubiquitin-conjugating enzyme E2K
domestic cat(101081979) ubiquitin-conjugating enzyme E2K
dog(609531) ubiquitin-conjugating enzyme E2K
cow(281225) ubiquitin-conjugating enzyme E2K
sheep(101109971) ubiquitin-conjugating enzyme E2K
domestic guinea pig(100716372) ubiquitin-conjugating enzyme E2K
143 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500510 Anti-HIP2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
AV43048 Anti-HIP2 antibody produced in rabbit IgG fraction of antiserum pig, rabbit, canine, guinea pig, bovine, horse, mouse, rat, zebrafish, human
western blot pricing
SAB2102623 Anti-UBE2K (ab1) antibody produced in rabbit affinity isolated antibody pig, mouse, bovine, guinea pig, canine, rat, horse, rabbit, zebrafish, human
western blot pricing
SAB2102624 Anti-UBE2K (ab2) antibody produced in rabbit affinity isolated antibody rat, guinea pig, pig, horse, rabbit, zebrafish, mouse, bovine, canine, human
western blot pricing
HPA028869 Anti-UBE2K antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2103280 Anti-UBE2K antibody produced in rabbit affinity isolated antibody canine, horse, bovine, pig, rabbit, mouse, guinea pig, zebrafish, human, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016786 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016786 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016786 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005339 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005339 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005339 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091111 MISSION® esiRNA esiRNA human UBE2K (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001111112 Rosetta Predictions human pricing
NM_001111113 Rosetta Predictions human pricing
NM_005339 Rosetta Predictions human pricing
NM_001106006 Rosetta Predictions rat pricing
NM_016786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325256 predicted 752
2 SASI_Hs02_00325257 predicted 1020
3 SASI_Hs02_00325258 predicted 362
4 SASI_Hs02_00325259 predicted 1035
5 SASI_Hs02_00325260 predicted 604
6 SASI_Hs02_00325261 predicted 434
7 SASI_Hs02_00325262 predicted 1022
8 SASI_Hs02_00325263 predicted 300
9 SASI_Hs02_00325264 predicted 726
10 SASI_Hs02_00325265 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325266 predicted 733
2 SASI_Hs02_00325267 predicted 557
3 SASI_Hs02_00325268 predicted 1015
4 SASI_Hs02_00325269 predicted 451
5 SASI_Hs02_00325270 predicted 736
6 SASI_Hs02_00325271 predicted 300
7 SASI_Hs02_00325272 predicted 508
8 SASI_Hs02_00325273 predicted 709
9 SASI_Hs02_00325274 predicted 625
10 SASI_Hs02_00325275 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229061 predicted 879
2 SASI_Hs01_00229055 predicted 715
3 SASI_Hs01_00229062 predicted 360
4 SASI_Hs01_00229056 predicted 602
5 SASI_Hs01_00229063 predicted 441
6 SASI_Hs01_00229064 predicted 889
7 SASI_Hs02_00339410 predicted 301
8 SASI_Hs01_00229057 predicted 658
9 SASI_Hs01_00229058 predicted 547
10 SASI_Hs02_00339411 predicted 861
11 SASI_Hs01_00229059 predicted 586
12 SASI_Hs01_00229060 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214702 predicted 1310
2 SASI_Rn02_00214703 predicted 638
3 SASI_Rn02_00214704 predicted 519
4 SASI_Rn02_00214705 predicted 677
5 SASI_Rn02_00214706 predicted 658
6 SASI_Rn02_00214707 predicted 522
7 SASI_Rn02_00214708 predicted 229
8 SASI_Rn02_00214709 predicted 1170
9 SASI_Rn02_00214710 predicted 511
10 SASI_Rn02_00214711 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323562 predicted 608
2 SASI_Mm01_00054158 predicted 668
3 SASI_Mm01_00054159 predicted 1309
4 SASI_Mm01_00054160 predicted 1246
5 SASI_Mm01_00054161 predicted 241
6 SASI_Mm01_00054163 predicted 1247
7 SASI_Mm01_00054164 predicted 685
8 SASI_Mm01_00054165 predicted 528
9 SASI_Mm01_00054166 predicted 527
10 SASI_Mm01_00054167 predicted 365
11 SASI_Mm01_00054162 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016786
VALIDATED
UBE2K MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2K
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016786.3-687s21c1
Sequence:CCGGCACCAGTTTCTAGTCCAGAATCTCGAGATTCTGGACTAGAAACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016786.3-613s21c1
Sequence:CCGGAGCGAATCAGTACAAACAGAACTCGAGTTCTGTTTGTACTGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016786.3-751s21c1
Sequence:CCGGGAACGCAGTAATAGTGGCCTTCTCGAGAAGGCCACTATTACTGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016786.3-1313s21c1
Sequence:CCGGTTAGGACATTCTTGAATTATGCTCGAGCATAATTCAAGAATGTCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016786.3-646s21c1
Sequence:CCGGCAAGCAGACAGCTCGACTTTGCTCGAGCAAAGTCGAGCTGTCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016786.2-1390s1c1
Sequence:CCGGGCGGAGATTCTCATGGTCAATCTCGAGATTGACCATGAGAATCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016786.2-532s1c1
Sequence:CCGGGCGCACGGTATTATTGTCATTCTCGAGAATGACAATAATACCGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016786.2-742s1c1
Sequence:CCGGGAACGCAGTAATAGTGGCCTTCTCGAGAAGGCCACTATTACTGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016786.2-604s1c1
Sequence:CCGGAGCGAATCAGTACAAACAGAACTCGAGTTCTGTTTGTACTGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016786.2-678s1c1
Sequence:CCGGCACCAGTTTCTAGTCCAGAATCTCGAGATTCTGGACTAGAAACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016786
VALIDATED
UBE2K MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2K
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016786.3-687s21c1
Sequence:CCGGCACCAGTTTCTAGTCCAGAATCTCGAGATTCTGGACTAGAAACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016786.3-613s21c1
Sequence:CCGGAGCGAATCAGTACAAACAGAACTCGAGTTCTGTTTGTACTGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016786.3-751s21c1
Sequence:CCGGGAACGCAGTAATAGTGGCCTTCTCGAGAAGGCCACTATTACTGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016786.3-1313s21c1
Sequence:CCGGTTAGGACATTCTTGAATTATGCTCGAGCATAATTCAAGAATGTCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016786.3-646s21c1
Sequence:CCGGCAAGCAGACAGCTCGACTTTGCTCGAGCAAAGTCGAGCTGTCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016786.2-1390s1c1
Sequence:CCGGGCGGAGATTCTCATGGTCAATCTCGAGATTGACCATGAGAATCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016786.2-532s1c1
Sequence:CCGGGCGCACGGTATTATTGTCATTCTCGAGAATGACAATAATACCGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016786.2-742s1c1
Sequence:CCGGGAACGCAGTAATAGTGGCCTTCTCGAGAAGGCCACTATTACTGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016786.2-604s1c1
Sequence:CCGGAGCGAATCAGTACAAACAGAACTCGAGTTCTGTTTGTACTGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016786.2-678s1c1
Sequence:CCGGCACCAGTTTCTAGTCCAGAATCTCGAGATTCTGGACTAGAAACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016786
VALIDATED
UBE2K MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2K
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016786.3-687s21c1
Sequence:CCGGCACCAGTTTCTAGTCCAGAATCTCGAGATTCTGGACTAGAAACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016786.3-613s21c1
Sequence:CCGGAGCGAATCAGTACAAACAGAACTCGAGTTCTGTTTGTACTGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016786.3-751s21c1
Sequence:CCGGGAACGCAGTAATAGTGGCCTTCTCGAGAAGGCCACTATTACTGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016786.3-1313s21c1
Sequence:CCGGTTAGGACATTCTTGAATTATGCTCGAGCATAATTCAAGAATGTCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016786.3-646s21c1
Sequence:CCGGCAAGCAGACAGCTCGACTTTGCTCGAGCAAAGTCGAGCTGTCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016786.2-1390s1c1
Sequence:CCGGGCGGAGATTCTCATGGTCAATCTCGAGATTGACCATGAGAATCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016786.2-532s1c1
Sequence:CCGGGCGCACGGTATTATTGTCATTCTCGAGAATGACAATAATACCGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016786.2-742s1c1
Sequence:CCGGGAACGCAGTAATAGTGGCCTTCTCGAGAAGGCCACTATTACTGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016786.2-604s1c1
Sequence:CCGGAGCGAATCAGTACAAACAGAACTCGAGTTCTGTTTGTACTGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016786.2-678s1c1
Sequence:CCGGCACCAGTTTCTAGTCCAGAATCTCGAGATTCTGGACTAGAAACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005339
VALIDATED
UBE2K MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2K
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005339.4-595s21c1
Sequence:CCGGTGACTCTCCGCACGGTATTATCTCGAGATAATACCGTGCGGAGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005339.4-2989s21c1
Sequence:CCGGATGAGCCCTATAGGGTTATATCTCGAGATATAACCCTATAGGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005339.4-805s21c1
Sequence:CCGGTTGATAGGAATGCAGTAATAGCTCGAGCTATTACTGCATTCCTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005339.4-469s21c1
Sequence:CCGGTACCAGAAACATACCCATTTACTCGAGTAAATGGGTATGTTTCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_005339.4-670s21c1
Sequence:CCGGTAGTAGCAAATCAGTACAAACCTCGAGGTTTGTACTGATTTGCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005339.3-1046s1c1
Sequence:CCGGGCCATTCAAATTGTTGGTGTTCTCGAGAACACCAACAATTTGAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005339.3-264s1c1
Sequence:CCGGCCAGAAACATACCCATTTAATCTCGAGATTAAATGGGTATGTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005339.3-588s1c1
Sequence:CCGGGCTATGGGCTTTGATAGGAATCTCGAGATTCCTATCAAAGCCCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005339.3-465s1c1
Sequence:CCGGGTAGCAAATCAGTACAAACAACTCGAGTTGTTTGTACTGATTTGCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005339.3-395s1c1
Sequence:CCGGCCGCACGGTATTATTGTCATTCTCGAGAATGACAATAATACCGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005339
VALIDATED
UBE2K MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2K
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005339.4-595s21c1
Sequence:CCGGTGACTCTCCGCACGGTATTATCTCGAGATAATACCGTGCGGAGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005339.4-2989s21c1
Sequence:CCGGATGAGCCCTATAGGGTTATATCTCGAGATATAACCCTATAGGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005339.4-805s21c1
Sequence:CCGGTTGATAGGAATGCAGTAATAGCTCGAGCTATTACTGCATTCCTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005339.4-469s21c1
Sequence:CCGGTACCAGAAACATACCCATTTACTCGAGTAAATGGGTATGTTTCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_005339.4-670s21c1
Sequence:CCGGTAGTAGCAAATCAGTACAAACCTCGAGGTTTGTACTGATTTGCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005339.3-1046s1c1
Sequence:CCGGGCCATTCAAATTGTTGGTGTTCTCGAGAACACCAACAATTTGAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005339.3-264s1c1
Sequence:CCGGCCAGAAACATACCCATTTAATCTCGAGATTAAATGGGTATGTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005339.3-588s1c1
Sequence:CCGGGCTATGGGCTTTGATAGGAATCTCGAGATTCCTATCAAAGCCCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005339.3-465s1c1
Sequence:CCGGGTAGCAAATCAGTACAAACAACTCGAGTTGTTTGTACTGATTTGCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005339.3-395s1c1
Sequence:CCGGCCGCACGGTATTATTGTCATTCTCGAGAATGACAATAATACCGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005339
VALIDATED
UBE2K MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2K
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005339.4-595s21c1
Sequence:CCGGTGACTCTCCGCACGGTATTATCTCGAGATAATACCGTGCGGAGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005339.4-2989s21c1
Sequence:CCGGATGAGCCCTATAGGGTTATATCTCGAGATATAACCCTATAGGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005339.4-805s21c1
Sequence:CCGGTTGATAGGAATGCAGTAATAGCTCGAGCTATTACTGCATTCCTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005339.4-469s21c1
Sequence:CCGGTACCAGAAACATACCCATTTACTCGAGTAAATGGGTATGTTTCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_005339.4-670s21c1
Sequence:CCGGTAGTAGCAAATCAGTACAAACCTCGAGGTTTGTACTGATTTGCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005339.3-1046s1c1
Sequence:CCGGGCCATTCAAATTGTTGGTGTTCTCGAGAACACCAACAATTTGAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005339.3-264s1c1
Sequence:CCGGCCAGAAACATACCCATTTAATCTCGAGATTAAATGGGTATGTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005339.3-588s1c1
Sequence:CCGGGCTATGGGCTTTGATAGGAATCTCGAGATTCCTATCAAAGCCCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005339.3-465s1c1
Sequence:CCGGGTAGCAAATCAGTACAAACAACTCGAGTTGTTTGTACTGATTTGCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005339.3-395s1c1
Sequence:CCGGCCGCACGGTATTATTGTCATTCTCGAGAATGACAATAATACCGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks