EMAIL THIS PAGE TO A FRIEND

UBE2L3

ubiquitin-conjugating enzyme E2L 3

Synonyms: E2-F1 L-UBC UBCH7 UbcM4
Gene ID:
Human(7332) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes (E1s), ubiquitin-conjugating enzymes (E2s) and ubiquitin-protein ligases (E3s). This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is demonstrated to participate in the ubiquitination of p53, c-Fos, and the NF-kB precursor p105 in vitro. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(22195) ubiquitin-conjugating enzyme E2L 3
Rat(363836) ubiquitin-conjugating enzyme E2L 3
chicken(416769) ubiquitin-conjugating enzyme E2L 3
domestic cat(101086349) ubiquitin-conjugating enzyme E2L 3
dog(477572) ubiquitin-conjugating enzyme E2L 3
domestic guinea pig(100714064) ubiquitin-conjugating enzyme E2L 3
naked mole-rat(101701594) ubiquitin-conjugating enzyme E2L 3
cow(767894) ubiquitin-conjugating enzyme E2L 3
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
U3009 Anti-UBE2L3 (111-125) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
U2884 Anti-UBE2L3 (91-105) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV43026 Anti-UBE2L3 (AB1) antibody produced in rabbit affinity isolated antibody , mouse, rat, guinea pig, rabbit, bovine, pig, human, zebrafish, horse, canine
western blot pricing
AV43025 Anti-UBE2L3 (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, human, horse, guinea pig, mouse, rabbit, zebrafish, pig, canine, rat
immunohistochemistry, western blot pricing
SAB2501081 Anti-UBE2L3 antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, rat, human, mouse
ELISA, western blot pricing
SAB2103279 Anti-UBE2L3 antibody produced in rabbit affinity isolated antibody rabbit, bovine, mouse, guinea pig, human, horse, canine, zebrafish, pig, rat
western blot pricing
HPA045609 Anti-UBE2L3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunohistochemistry, western blot pricing
HPA062415 Anti-UBE2L3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
WH0007332M1 Monoclonal Anti-UBE2L3 antibody produced in mouse clone 3B7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003347 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009456 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009456 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009456 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003347 Rosetta Predictions human pricing
NM_198157 Rosetta Predictions human pricing
NM_001108847 Rosetta Predictions rat pricing
NM_009456 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049984 predicted 740
2 SASI_Hs01_00049991 predicted 178
3 SASI_Hs01_00049985 predicted 195
4 SASI_Hs02_00335501 predicted 152
5 SASI_Hs01_00049986 predicted 134
6 SASI_Hs01_00049987 predicted 86
7 SASI_Hs01_00049988 predicted 195
8 SASI_Hs02_00335502 predicted 165
9 SASI_Hs01_00049989 predicted 97
10 SASI_Hs01_00049990 predicted 301
11 SASI_Hs01_00049992 predicted 664
12 SASI_Hs01_00049993 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163856 predicted 848
2 SASI_Hs02_00371701 predicted 181
3 SASI_Hs01_00163857 predicted 91
4 SASI_Hs01_00163858 predicted 198
5 SASI_Hs02_00371702 predicted 155
6 SASI_Hs01_00163859 predicted 385
7 SASI_Hs01_00163860 predicted 418
8 SASI_Hs01_00163861 predicted 466
9 SASI_Hs02_00371703 predicted 158
10 SASI_Hs02_00371704 predicted 243
11 SASI_Hs01_00163862 predicted 147
12 SASI_Hs01_00163863 predicted 446
13 SASI_Hs01_00163864 predicted 115
14 SASI_Hs01_00163865 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108847 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242665 predicted 2275
2 SASI_Rn02_00242666 predicted 2221
3 SASI_Rn02_00242667 predicted 2270
4 SASI_Rn02_00242668 predicted 2128
5 SASI_Rn02_00242669 predicted 2160
6 SASI_Rn02_00242670 predicted 2149
7 SASI_Rn02_00242671 predicted 2124
8 SASI_Rn02_00242672 predicted 2254
9 SASI_Rn02_00242673 predicted 2212
10 SASI_Rn02_00242674 predicted 2121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009456 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050475 predicted 915
2 SASI_Mm01_00050476 predicted 780
3 SASI_Mm01_00050477 predicted 962
4 SASI_Mm01_00050478 predicted 778
5 SASI_Mm02_00316164 predicted 972
6 SASI_Mm01_00050480 predicted 647
7 SASI_Mm01_00050481 predicted 247
8 SASI_Mm01_00050482 predicted 436
9 SASI_Mm01_00050483 predicted 609
10 SASI_Mm01_00050484 predicted 323
11 SASI_Mm01_00050479 predicted 499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003347
VALIDATED
UBE2L3 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2L 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003347.2-1795s1c1
Sequence:CCGGCCTTAGAATTTATCGTCAGATCTCGAGATCTGACGATAAATTCTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003347.2-249s1c1
Sequence:CCGGCCAGCAGAGTACCCATTCAAACTCGAGTTTGAATGGGTACTCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003347.2-459s1c1
Sequence:CCGGGAATACTCTAAGGACCGTAAACTCGAGTTTACGGTCCTTAGAGTATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003347.2-270s1c1
Sequence:CCGGCCACCGAAGATCACATTTAAACTCGAGTTTAAATGTGATCTTCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003347.2-165s1c1
Sequence:CCGGGCTAATTTATTGACTTGGCAACTCGAGTTGCCAAGTCAATAAATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003347.2-270s21c1
Sequence:CCGGCCACCGAAGATCACATTTAAACTCGAGTTTAAATGTGATCTTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_003347.2-918s21c1
Sequence:CCGGCACTTTCTGGCACCGAGTTTACTCGAGTAAACTCGGTGCCAGAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003347.2-328s21c1
Sequence:CCGGAGGTCTGTCTGCCAGTAATTACTCGAGTAATTACTGGCAGACAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003347.2-459s21c1
Sequence:CCGGGAATACTCTAAGGACCGTAAACTCGAGTTTACGGTCCTTAGAGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003347.2-249s21c1
Sequence:CCGGCCAGCAGAGTACCCATTCAAACTCGAGTTTGAATGGGTACTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003347
VALIDATED
UBE2L3 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2L 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003347.2-1795s1c1
Sequence:CCGGCCTTAGAATTTATCGTCAGATCTCGAGATCTGACGATAAATTCTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003347.2-249s1c1
Sequence:CCGGCCAGCAGAGTACCCATTCAAACTCGAGTTTGAATGGGTACTCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003347.2-459s1c1
Sequence:CCGGGAATACTCTAAGGACCGTAAACTCGAGTTTACGGTCCTTAGAGTATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003347.2-270s1c1
Sequence:CCGGCCACCGAAGATCACATTTAAACTCGAGTTTAAATGTGATCTTCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003347.2-165s1c1
Sequence:CCGGGCTAATTTATTGACTTGGCAACTCGAGTTGCCAAGTCAATAAATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003347.2-270s21c1
Sequence:CCGGCCACCGAAGATCACATTTAAACTCGAGTTTAAATGTGATCTTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_003347.2-918s21c1
Sequence:CCGGCACTTTCTGGCACCGAGTTTACTCGAGTAAACTCGGTGCCAGAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003347.2-328s21c1
Sequence:CCGGAGGTCTGTCTGCCAGTAATTACTCGAGTAATTACTGGCAGACAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003347.2-459s21c1
Sequence:CCGGGAATACTCTAAGGACCGTAAACTCGAGTTTACGGTCCTTAGAGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003347.2-249s21c1
Sequence:CCGGCCAGCAGAGTACCCATTCAAACTCGAGTTTGAATGGGTACTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003347
VALIDATED
UBE2L3 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2L 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003347.2-1795s1c1
Sequence:CCGGCCTTAGAATTTATCGTCAGATCTCGAGATCTGACGATAAATTCTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003347.2-249s1c1
Sequence:CCGGCCAGCAGAGTACCCATTCAAACTCGAGTTTGAATGGGTACTCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003347.2-459s1c1
Sequence:CCGGGAATACTCTAAGGACCGTAAACTCGAGTTTACGGTCCTTAGAGTATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003347.2-270s1c1
Sequence:CCGGCCACCGAAGATCACATTTAAACTCGAGTTTAAATGTGATCTTCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003347.2-165s1c1
Sequence:CCGGGCTAATTTATTGACTTGGCAACTCGAGTTGCCAAGTCAATAAATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003347.2-270s21c1
Sequence:CCGGCCACCGAAGATCACATTTAAACTCGAGTTTAAATGTGATCTTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_003347.2-918s21c1
Sequence:CCGGCACTTTCTGGCACCGAGTTTACTCGAGTAAACTCGGTGCCAGAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003347.2-328s21c1
Sequence:CCGGAGGTCTGTCTGCCAGTAATTACTCGAGTAATTACTGGCAGACAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003347.2-459s21c1
Sequence:CCGGGAATACTCTAAGGACCGTAAACTCGAGTTTACGGTCCTTAGAGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003347.2-249s21c1
Sequence:CCGGCCAGCAGAGTACCCATTCAAACTCGAGTTTGAATGGGTACTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009456
VALIDATED
UBE2L3 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2L 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009456.1-1517s1c1
Sequence:CCGGCCCTCTGGATTCCAAACCTTTCTCGAGAAAGGTTTGGAATCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009456.1-203s1c1
Sequence:CCGGCCAGCAGAGTATCCATTCAAACTCGAGTTTGAATGGATACTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009456.1-224s1c1
Sequence:CCGGCCACCCAAGATCACATTTAAACTCGAGTTTAAATGTGATCTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009456.1-324s1c1
Sequence:CCGGCCACCAAGACTGACCAAGTAACTCGAGTTACTTGGTCAGTCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009456.1-449s1c1
Sequence:CCGGGCTGAAGAGTTTACAAAGAAACTCGAGTTTCTTTGTAAACTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009456.2-203s21c1
Sequence:CCGGCCAGCAGAGTATCCATTCAAACTCGAGTTTGAATGGATACTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009456.2-224s21c1
Sequence:CCGGCCACCCAAGATCACATTTAAACTCGAGTTTAAATGTGATCTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009456.2-449s21c1
Sequence:CCGGGCTGAAGAGTTTACAAAGAAACTCGAGTTTCTTTGTAAACTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009456.2-324s21c1
Sequence:CCGGCCACCAAGACTGACCAAGTAACTCGAGTTACTTGGTCAGTCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009456
VALIDATED
UBE2L3 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2L 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009456.1-1517s1c1
Sequence:CCGGCCCTCTGGATTCCAAACCTTTCTCGAGAAAGGTTTGGAATCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009456.1-203s1c1
Sequence:CCGGCCAGCAGAGTATCCATTCAAACTCGAGTTTGAATGGATACTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009456.1-224s1c1
Sequence:CCGGCCACCCAAGATCACATTTAAACTCGAGTTTAAATGTGATCTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009456.1-324s1c1
Sequence:CCGGCCACCAAGACTGACCAAGTAACTCGAGTTACTTGGTCAGTCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009456.1-449s1c1
Sequence:CCGGGCTGAAGAGTTTACAAAGAAACTCGAGTTTCTTTGTAAACTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009456.2-203s21c1
Sequence:CCGGCCAGCAGAGTATCCATTCAAACTCGAGTTTGAATGGATACTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009456.2-224s21c1
Sequence:CCGGCCACCCAAGATCACATTTAAACTCGAGTTTAAATGTGATCTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009456.2-449s21c1
Sequence:CCGGGCTGAAGAGTTTACAAAGAAACTCGAGTTTCTTTGTAAACTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009456.2-324s21c1
Sequence:CCGGCCACCAAGACTGACCAAGTAACTCGAGTTACTTGGTCAGTCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009456
VALIDATED
UBE2L3 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2L 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009456.1-1517s1c1
Sequence:CCGGCCCTCTGGATTCCAAACCTTTCTCGAGAAAGGTTTGGAATCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009456.1-203s1c1
Sequence:CCGGCCAGCAGAGTATCCATTCAAACTCGAGTTTGAATGGATACTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009456.1-224s1c1
Sequence:CCGGCCACCCAAGATCACATTTAAACTCGAGTTTAAATGTGATCTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009456.1-324s1c1
Sequence:CCGGCCACCAAGACTGACCAAGTAACTCGAGTTACTTGGTCAGTCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009456.1-449s1c1
Sequence:CCGGGCTGAAGAGTTTACAAAGAAACTCGAGTTTCTTTGTAAACTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009456.2-203s21c1
Sequence:CCGGCCAGCAGAGTATCCATTCAAACTCGAGTTTGAATGGATACTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009456.2-224s21c1
Sequence:CCGGCCACCCAAGATCACATTTAAACTCGAGTTTAAATGTGATCTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009456.2-449s21c1
Sequence:CCGGGCTGAAGAGTTTACAAAGAAACTCGAGTTTCTTTGTAAACTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009456.2-324s21c1
Sequence:CCGGCCACCAAGACTGACCAAGTAACTCGAGTTACTTGGTCAGTCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks