EMAIL THIS PAGE TO A FRIEND

UBE2L6

ubiquitin-conjugating enzyme E2L 6

Synonyms: RIG-B UBCH8
UniProtKB ID: O14933, A6NDM6, A8MY53, Q8N5D8, Q9UEZ0
Gene ID:
Human(9246) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes (E1s), ubiquitin-conjugating enzymes (E2s) and ubiquitin-protein ligases (E3s). This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is highly similar in primary structure to the enzyme encoded by the UBE2L3 gene. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2011]
Mouse(56791) ubiquitin-conjugating enzyme E2L 6
Rat(295704) ubiquitin-conjugating enzyme E2L 6
dog(475967) ubiquitin-conjugating enzyme E2L 6
domestic cat(101090548) ubiquitin-conjugating enzyme E2L 6
cow(509471) ubiquitin-conjugating enzyme E2L 6
sheep(101121201) ubiquitin-conjugating enzyme E2L 6
naked mole-rat(101725275) ubiquitin-conjugating enzyme E2L 6
domestic guinea pig(100722134) ubiquitin-conjugating enzyme E2L 6
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019949 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019949 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019949 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004223 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157291 MISSION® esiRNA esiRNA human UBE2L6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004223 Rosetta Predictions human pricing
NM_198183 Rosetta Predictions human pricing
NM_001024755 Rosetta Predictions rat pricing
NM_019949 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205565 predicted 1024
2 SASI_Hs01_00205566 predicted 1006
3 SASI_Hs01_00205567 predicted 352
4 SASI_Hs01_00205568 predicted 425
5 SASI_Hs01_00205569 predicted 976
6 SASI_Hs01_00205570 predicted 1007
7 SASI_Hs01_00205572 predicted 1031
8 SASI_Hs02_00337136 predicted 993
9 SASI_Hs02_00337137 predicted 952
10 SASI_Hs01_00205574 predicted 951
11 SASI_Hs01_00205571 predicted 1019
12 SASI_Hs01_00205573 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100112 predicted 1033
2 SASI_Hs01_00100113 predicted 1022
3 SASI_Hs01_00100114 predicted 358
4 SASI_Hs01_00100115 predicted 429
5 SASI_Hs01_00100116 predicted 979
6 SASI_Hs01_00100117 predicted 1013
7 SASI_Hs01_00100119 predicted 1046
8 SASI_Hs02_00371721 predicted 1005
9 SASI_Hs02_00371722 predicted 955
10 SASI_Hs01_00100121 predicted 959
11 SASI_Hs01_00100118 predicted 1023
12 SASI_Hs01_00100120 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024755 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036853 predicted 1140
2 SASI_Rn01_00036854 predicted 649
3 SASI_Rn01_00036855 predicted 942
4 SASI_Rn01_00036856 predicted 1174
5 SASI_Rn01_00036857 predicted 917
6 SASI_Rn01_00036858 predicted 471
7 SASI_Rn01_00036859 predicted 781
8 SASI_Rn01_00036861 predicted 908
9 SASI_Rn02_00202632 predicted 548
10 SASI_Rn02_00202633 predicted 987
11 SASI_Rn01_00036860 predicted 534
12 SASI_Rn01_00036862 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019949 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031843 predicted 737
2 SASI_Mm01_00031844 predicted 774
3 SASI_Mm01_00031845 predicted 260
4 SASI_Mm01_00031846 predicted 452
5 SASI_Mm01_00031847 predicted 809
6 SASI_Mm01_00031849 predicted 614
7 SASI_Mm01_00031850 predicted 244
8 SASI_Mm02_00325246 predicted 199
9 SASI_Mm01_00031851 predicted 592
10 SASI_Mm01_00031852 predicted 707
11 SASI_Mm01_00031848 predicted 460
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019949
UBE2L6 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2L 6
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019949.2-400s21c1
Sequence:CCGGCTCAATGTGCTGGTGAGTAAACTCGAGTTTACTCACCAGCACATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019949.2-283s21c1
Sequence:CCGGAGATTCACCACCAAGATCTACCTCGAGGTAGATCTTGGTGGTGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019949.1-915s1c1
Sequence:CCGGCCAAATTTACTGTTGAGTGATCTCGAGATCACTCAACAGTAAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019949.1-353s1c1
Sequence:CCGGCCTTACACCAAGCCTTATCAACTCGAGTTGATAAGGCTTGGTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019949.1-213s1c1
Sequence:CCGGCCTTCCAAGTGCGGATTGATTCTCGAGAATCAATCCGCACTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019949.1-131s1c1
Sequence:CCGGCGCCAACTGTCTAGTGACTATCTCGAGATAGTCACTAGACAGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019949.1-482s1c1
Sequence:CCGGGCAGAAGAGTTCACCCTTAAACTCGAGTTTAAGGGTGAACTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019949
UBE2L6 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2L 6
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019949.2-400s21c1
Sequence:CCGGCTCAATGTGCTGGTGAGTAAACTCGAGTTTACTCACCAGCACATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019949.2-283s21c1
Sequence:CCGGAGATTCACCACCAAGATCTACCTCGAGGTAGATCTTGGTGGTGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019949.1-915s1c1
Sequence:CCGGCCAAATTTACTGTTGAGTGATCTCGAGATCACTCAACAGTAAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019949.1-353s1c1
Sequence:CCGGCCTTACACCAAGCCTTATCAACTCGAGTTGATAAGGCTTGGTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019949.1-213s1c1
Sequence:CCGGCCTTCCAAGTGCGGATTGATTCTCGAGAATCAATCCGCACTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019949.1-131s1c1
Sequence:CCGGCGCCAACTGTCTAGTGACTATCTCGAGATAGTCACTAGACAGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019949.1-482s1c1
Sequence:CCGGGCAGAAGAGTTCACCCTTAAACTCGAGTTTAAGGGTGAACTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019949
UBE2L6 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2L 6
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019949.2-400s21c1
Sequence:CCGGCTCAATGTGCTGGTGAGTAAACTCGAGTTTACTCACCAGCACATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019949.2-283s21c1
Sequence:CCGGAGATTCACCACCAAGATCTACCTCGAGGTAGATCTTGGTGGTGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019949.1-915s1c1
Sequence:CCGGCCAAATTTACTGTTGAGTGATCTCGAGATCACTCAACAGTAAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019949.1-353s1c1
Sequence:CCGGCCTTACACCAAGCCTTATCAACTCGAGTTGATAAGGCTTGGTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019949.1-213s1c1
Sequence:CCGGCCTTCCAAGTGCGGATTGATTCTCGAGAATCAATCCGCACTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019949.1-131s1c1
Sequence:CCGGCGCCAACTGTCTAGTGACTATCTCGAGATAGTCACTAGACAGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019949.1-482s1c1
Sequence:CCGGGCAGAAGAGTTCACCCTTAAACTCGAGTTTAAGGGTGAACTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004223
UBE2L6 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2L 6
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000007281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004223.3-1082s1c1
Sequence:CCGGGAATCAAACTTCCATCCTGAACTCGAGTTCAGGATGGAAGTTTGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004223.3-297s1c1
Sequence:CCGGGATCAAATTCACAACCAAGATCTCGAGATCTTGGTTGTGAATTTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004223.3-499s1c1
Sequence:CCGGCTGTTCAGAAAGAATGCCGAACTCGAGTTCGGCATTCTTTCTGAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004223.3-426s1c1
Sequence:CCGGGCTGGTGAATAGACCGAATATCTCGAGATATTCGGTCTATTCACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004223
UBE2L6 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2L 6
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000007281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004223.3-1082s1c1
Sequence:CCGGGAATCAAACTTCCATCCTGAACTCGAGTTCAGGATGGAAGTTTGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004223.3-297s1c1
Sequence:CCGGGATCAAATTCACAACCAAGATCTCGAGATCTTGGTTGTGAATTTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004223.3-499s1c1
Sequence:CCGGCTGTTCAGAAAGAATGCCGAACTCGAGTTCGGCATTCTTTCTGAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004223.3-426s1c1
Sequence:CCGGGCTGGTGAATAGACCGAATATCTCGAGATATTCGGTCTATTCACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004223
UBE2L6 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2L 6
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000007281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004223.3-1082s1c1
Sequence:CCGGGAATCAAACTTCCATCCTGAACTCGAGTTCAGGATGGAAGTTTGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004223.3-297s1c1
Sequence:CCGGGATCAAATTCACAACCAAGATCTCGAGATCTTGGTTGTGAATTTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004223.3-499s1c1
Sequence:CCGGCTGTTCAGAAAGAATGCCGAACTCGAGTTCGGCATTCTTTCTGAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004223.3-426s1c1
Sequence:CCGGGCTGGTGAATAGACCGAATATCTCGAGATATTCGGTCTATTCACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks