EMAIL THIS PAGE TO A FRIEND

UBE2M

ubiquitin-conjugating enzyme E2M

Synonyms: UBC-RS2 UBC12 hUbc12
UniProtKB ID: P61081, O76069, Q8VC50
Gene ID:
Human(9040) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein is linked with a ubiquitin-like protein, NEDD8, which can be conjugated to cellular proteins, such as Cdc53/culin. [provided by RefSeq, Jul 2008]
Mouse(22192) ubiquitin-conjugating enzyme E2M
Rat(361509) ubiquitin-conjugating enzyme E2M
domestic guinea pig(100716983) ubiquitin-conjugating enzyme E2M
naked mole-rat(101721696) ubiquitin-conjugating enzyme E2M
cow(613343) ubiquitin-conjugating enzyme E2M
sheep(101121449) ubiquitin-conjugating enzyme E2M
chicken(100858641) ubiquitin-conjugating enzyme E2M
dog(484221) ubiquitin-conjugating enzyme E2M
domestic cat(101088703) ubiquitin-conjugating enzyme E2M
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003969 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003969 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003969 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145578 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145578 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145578 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003969 Rosetta Predictions human pricing
NM_001108471 Rosetta Predictions rat pricing
NM_145578 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232487 predicted 985
2 SASI_Hs01_00232488 predicted 964
3 SASI_Hs01_00232489 predicted 865
4 SASI_Hs01_00232490 predicted 943
5 SASI_Hs01_00232491 predicted 949
6 SASI_Hs01_00232492 predicted 798
7 SASI_Hs01_00232493 predicted 943
8 SASI_Hs01_00232494 predicted 867
9 SASI_Hs01_00232495 predicted 836
10 SASI_Hs01_00232496 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108471 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238969 predicted 938
2 SASI_Rn02_00238970 predicted 934
3 SASI_Rn02_00238971 predicted 790
4 SASI_Rn02_00238972 predicted 1608
5 SASI_Rn02_00238973 predicted 924
6 SASI_Rn02_00238974 predicted 852
7 SASI_Rn02_00238975 predicted 938
8 SASI_Rn02_00238976 predicted 928
9 SASI_Rn02_00238977 predicted 1527
10 SASI_Rn02_00238978 predicted 1615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100414 predicted 572
2 SASI_Mm01_00100421 predicted 612
3 SASI_Mm01_00100422 predicted 610
4 SASI_Mm01_00100423 predicted 463
5 SASI_Mm02_00341103 predicted 617
6 SASI_Mm02_00341104 predicted 519
7 SASI_Mm02_00341105 predicted 460
8 SASI_Mm02_00341106 predicted 612
9 SASI_Mm02_00341107 predicted 603
10 SASI_Mm02_00341108 predicted 522
11 SASI_Mm01_00100415 predicted 516
12 SASI_Mm01_00100416 predicted 545
13 SASI_Mm01_00100417 predicted 686
14 SASI_Mm01_00100418 predicted 572
15 SASI_Mm01_00100419 predicted 538
16 SASI_Mm01_00100420 predicted 713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003969
VALIDATED
UBE2M MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2M
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003969.2-1351s1c1
Sequence:CCGGCGATGGGAAATGAATTGGCTTCTCGAGAAGCCAATTCATTTCCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003969.2-860s1c1
Sequence:CCGGCAAGGTGAAGTGTGAGACAATCTCGAGATTGTCTCACACTTCACCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003969.2-713s1c1
Sequence:CCGGCCTGCCCAAGACGTGTGATATCTCGAGATATCACACGTCTTGGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003969.2-794s1c1
Sequence:CCGGCTTCTACAAGAGTGGGAAGTTCTCGAGAACTTCCCACTCTTGTAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003969.2-683s1c1
Sequence:CCGGGCGGATCCAGAAGGACATAAACTCGAGTTTATGTCCTTCTGGATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003969.3-691s21c1
Sequence:CCGGGCGGATCCAGAAGGACATAAACTCGAGTTTATGTCCTTCTGGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003969.3-1110s21c1
Sequence:CCGGACATCGGCTCCACCTACTTTGCTCGAGCAAAGTAGGTGGAGCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003969.3-802s21c1
Sequence:CCGGCTTCTACAAGAGTGGGAAGTTCTCGAGAACTTCCCACTCTTGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003969.3-721s21c1
Sequence:CCGGCCTGCCCAAGACGTGTGATATCTCGAGATATCACACGTCTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003969
VALIDATED
UBE2M MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2M
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003969.2-1351s1c1
Sequence:CCGGCGATGGGAAATGAATTGGCTTCTCGAGAAGCCAATTCATTTCCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003969.2-860s1c1
Sequence:CCGGCAAGGTGAAGTGTGAGACAATCTCGAGATTGTCTCACACTTCACCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003969.2-713s1c1
Sequence:CCGGCCTGCCCAAGACGTGTGATATCTCGAGATATCACACGTCTTGGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003969.2-794s1c1
Sequence:CCGGCTTCTACAAGAGTGGGAAGTTCTCGAGAACTTCCCACTCTTGTAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003969.2-683s1c1
Sequence:CCGGGCGGATCCAGAAGGACATAAACTCGAGTTTATGTCCTTCTGGATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003969.3-691s21c1
Sequence:CCGGGCGGATCCAGAAGGACATAAACTCGAGTTTATGTCCTTCTGGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003969.3-1110s21c1
Sequence:CCGGACATCGGCTCCACCTACTTTGCTCGAGCAAAGTAGGTGGAGCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003969.3-802s21c1
Sequence:CCGGCTTCTACAAGAGTGGGAAGTTCTCGAGAACTTCCCACTCTTGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003969.3-721s21c1
Sequence:CCGGCCTGCCCAAGACGTGTGATATCTCGAGATATCACACGTCTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003969
VALIDATED
UBE2M MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2M
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003969.2-1351s1c1
Sequence:CCGGCGATGGGAAATGAATTGGCTTCTCGAGAAGCCAATTCATTTCCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003969.2-860s1c1
Sequence:CCGGCAAGGTGAAGTGTGAGACAATCTCGAGATTGTCTCACACTTCACCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003969.2-713s1c1
Sequence:CCGGCCTGCCCAAGACGTGTGATATCTCGAGATATCACACGTCTTGGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003969.2-794s1c1
Sequence:CCGGCTTCTACAAGAGTGGGAAGTTCTCGAGAACTTCCCACTCTTGTAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003969.2-683s1c1
Sequence:CCGGGCGGATCCAGAAGGACATAAACTCGAGTTTATGTCCTTCTGGATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003969.3-691s21c1
Sequence:CCGGGCGGATCCAGAAGGACATAAACTCGAGTTTATGTCCTTCTGGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003969.3-1110s21c1
Sequence:CCGGACATCGGCTCCACCTACTTTGCTCGAGCAAAGTAGGTGGAGCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003969.3-802s21c1
Sequence:CCGGCTTCTACAAGAGTGGGAAGTTCTCGAGAACTTCCCACTCTTGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003969.3-721s21c1
Sequence:CCGGCCTGCCCAAGACGTGTGATATCTCGAGATATCACACGTCTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145578
VALIDATED
UBE2M MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2M
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145578.1-613s1c1
Sequence:CCGGCCTTACGATAAACTCCATAATCTCGAGATTATGGAGTTTATCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145578.1-468s1c1
Sequence:CCGGGCAAGTTTGTATTCAGCTTTACTCGAGTAAAGCTGAATACAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145578.1-519s1c1
Sequence:CCGGCCAAGGTGAAGTGTGAAACAACTCGAGTTGTTTCACACTTCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145578.1-742s1c1
Sequence:CCGGGCGCTCCATGAGAGGTGGTTACTCGAGTAACCACCTCTCATGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145578.1-418s1c1
Sequence:CCGGCCTCAACTTCAAGCTGGTGATCTCGAGATCACCAGCTTGAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145578.1-951s21c1
Sequence:CCGGTTTGACCACCACGTGATTATGCTCGAGCATAATCACGTGGTGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145578.1-468s21c1
Sequence:CCGGGCAAGTTTGTATTCAGCTTTACTCGAGTAAAGCTGAATACAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145578.1-614s21c1
Sequence:CCGGCTTACGATAAACTCCATAATTCTCGAGAATTATGGAGTTTATCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145578.1-342s21c1
Sequence:CCGGTCCGGATTCAGAAGGACATTACTCGAGTAATGTCCTTCTGAATCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145578.1-418s21c1
Sequence:CCGGCCTCAACTTCAAGCTGGTGATCTCGAGATCACCAGCTTGAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145578
VALIDATED
UBE2M MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2M
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145578.1-613s1c1
Sequence:CCGGCCTTACGATAAACTCCATAATCTCGAGATTATGGAGTTTATCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145578.1-468s1c1
Sequence:CCGGGCAAGTTTGTATTCAGCTTTACTCGAGTAAAGCTGAATACAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145578.1-519s1c1
Sequence:CCGGCCAAGGTGAAGTGTGAAACAACTCGAGTTGTTTCACACTTCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145578.1-742s1c1
Sequence:CCGGGCGCTCCATGAGAGGTGGTTACTCGAGTAACCACCTCTCATGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145578.1-418s1c1
Sequence:CCGGCCTCAACTTCAAGCTGGTGATCTCGAGATCACCAGCTTGAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145578.1-951s21c1
Sequence:CCGGTTTGACCACCACGTGATTATGCTCGAGCATAATCACGTGGTGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145578.1-468s21c1
Sequence:CCGGGCAAGTTTGTATTCAGCTTTACTCGAGTAAAGCTGAATACAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145578.1-614s21c1
Sequence:CCGGCTTACGATAAACTCCATAATTCTCGAGAATTATGGAGTTTATCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145578.1-342s21c1
Sequence:CCGGTCCGGATTCAGAAGGACATTACTCGAGTAATGTCCTTCTGAATCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145578.1-418s21c1
Sequence:CCGGCCTCAACTTCAAGCTGGTGATCTCGAGATCACCAGCTTGAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145578
VALIDATED
UBE2M MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2M
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145578.1-613s1c1
Sequence:CCGGCCTTACGATAAACTCCATAATCTCGAGATTATGGAGTTTATCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145578.1-468s1c1
Sequence:CCGGGCAAGTTTGTATTCAGCTTTACTCGAGTAAAGCTGAATACAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145578.1-519s1c1
Sequence:CCGGCCAAGGTGAAGTGTGAAACAACTCGAGTTGTTTCACACTTCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145578.1-742s1c1
Sequence:CCGGGCGCTCCATGAGAGGTGGTTACTCGAGTAACCACCTCTCATGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145578.1-418s1c1
Sequence:CCGGCCTCAACTTCAAGCTGGTGATCTCGAGATCACCAGCTTGAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145578.1-951s21c1
Sequence:CCGGTTTGACCACCACGTGATTATGCTCGAGCATAATCACGTGGTGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145578.1-468s21c1
Sequence:CCGGGCAAGTTTGTATTCAGCTTTACTCGAGTAAAGCTGAATACAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145578.1-614s21c1
Sequence:CCGGCTTACGATAAACTCCATAATTCTCGAGAATTATGGAGTTTATCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145578.1-342s21c1
Sequence:CCGGTCCGGATTCAGAAGGACATTACTCGAGTAATGTCCTTCTGAATCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145578.1-418s21c1
Sequence:CCGGCCTCAACTTCAAGCTGGTGATCTCGAGATCACCAGCTTGAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks