EMAIL THIS PAGE TO A FRIEND

UBE2N

ubiquitin-conjugating enzyme E2N

Synonyms: UBC13 UbcH-ben UbcH13
UniProtKB ID: P61088, Q16781, Q53Y81
Gene ID:
Human(7334) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Studies in mouse suggest that this protein plays a role in DNA postreplication repair. [provided by RefSeq, Jul 2008]
Mouse(93765) ubiquitin-conjugating enzyme E2N
Rat(116725) ubiquitin-conjugating enzyme E2N
chicken(417898) ubiquitin-conjugating enzyme E2N
domestic cat(101089280) ubiquitin-conjugating enzyme E2N
dog(611865) ubiquitin-conjugating enzyme E2N
cow(541130) ubiquitin-conjugating enzyme E2N
sheep(100302360) ubiquitin-conjugating enzyme E2N
naked mole-rat(101718881) ubiquitin-conjugating enzyme E2N
domestic guinea pig(100726684) ubiquitin-conjugating enzyme E2N
159 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003348 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080560 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080560 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080560 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003348 Rosetta Predictions human pricing
NM_053928 Rosetta Predictions rat pricing
NM_080560 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012964 predicted 930
2 SASI_Hs01_00012965 predicted 609
3 SASI_Hs01_00012966 predicted 873
4 SASI_Hs01_00012972 predicted 602
5 SASI_Hs01_00012967 predicted 861
6 SASI_Hs01_00012968 predicted 856
7 SASI_Hs01_00012969 predicted 603
8 SASI_Hs01_00012970 predicted 608
9 SASI_Hs01_00012971 predicted 529
10 SASI_Hs01_00012973 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053928 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113352 predicted 763
2 SASI_Rn02_00266877 predicted 760
3 SASI_Rn01_00113351 predicted 678
4 SASI_Rn01_00113353 predicted 772
5 SASI_Rn01_00113354 predicted 580
6 SASI_Rn01_00113355 predicted 578
7 SASI_Rn02_00266878 predicted 377
8 SASI_Rn01_00113357 predicted 634
9 SASI_Rn01_00113358 predicted 724
10 SASI_Rn02_00266879 predicted 662
11 SASI_Rn01_00113356 predicted 885
12 SASI_Rn01_00113359 predicted 707
13 SASI_Rn01_00113360 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338165 predicted 240
2 SASI_Mm01_00090140 predicted 409
3 SASI_Mm02_00338166 predicted 236
4 SASI_Mm01_00090134 predicted 436
5 SASI_Mm01_00090135 predicted 393
6 SASI_Mm01_00090136 predicted 484
7 SASI_Mm01_00090137 predicted 293
8 SASI_Mm01_00090138 predicted 437
9 SASI_Mm01_00090139 predicted 481
10 SASI_Mm01_00090141 predicted 291
11 SASI_Mm01_00090142 predicted 352
12 SASI_Mm01_00090143 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003348
VALIDATED
UBE2N MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2N
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003348.3-606s21c1
Sequence:CCGGAGACAAGTTGGGAAGAATATGCTCGAGCATATTCTTCCCAACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_003348.3-537s21c1
Sequence:CCGGCCTTCCAGAAGAATACCCAATCTCGAGATTGGGTATTCTTCTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003348.3-694s21c1
Sequence:CCGGGCCTTGTTAAGTGCTCCCAATCTCGAGATTGGGAGCACTTAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003348.3-434s21c1
Sequence:CCGGTCAAAGCCGAACCAGATGAGACTCGAGTCTCATCTGGTTCGGCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003348.3-773s21c1
Sequence:CCGGCCATAGAAACAGCTAGAGCATCTCGAGATGCTCTAGCTGTTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003348.3-2012s1c1
Sequence:CCGGGCTGAGGCATTTGTGAGTCTTCTCGAGAAGACTCACAAATGCCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003348.3-694s1c1
Sequence:CCGGGCCTTGTTAAGTGCTCCCAATCTCGAGATTGGGAGCACTTAACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003348.3-797s1c1
Sequence:CCGGCTAGGCTATATGCCATGAATACTCGAGTATTCATGGCATATAGCCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003348.3-773s1c1
Sequence:CCGGCCATAGAAACAGCTAGAGCATCTCGAGATGCTCTAGCTGTTTCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003348
VALIDATED
UBE2N MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2N
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003348.3-606s21c1
Sequence:CCGGAGACAAGTTGGGAAGAATATGCTCGAGCATATTCTTCCCAACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_003348.3-537s21c1
Sequence:CCGGCCTTCCAGAAGAATACCCAATCTCGAGATTGGGTATTCTTCTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003348.3-694s21c1
Sequence:CCGGGCCTTGTTAAGTGCTCCCAATCTCGAGATTGGGAGCACTTAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003348.3-434s21c1
Sequence:CCGGTCAAAGCCGAACCAGATGAGACTCGAGTCTCATCTGGTTCGGCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003348.3-773s21c1
Sequence:CCGGCCATAGAAACAGCTAGAGCATCTCGAGATGCTCTAGCTGTTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003348.3-2012s1c1
Sequence:CCGGGCTGAGGCATTTGTGAGTCTTCTCGAGAAGACTCACAAATGCCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003348.3-694s1c1
Sequence:CCGGGCCTTGTTAAGTGCTCCCAATCTCGAGATTGGGAGCACTTAACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003348.3-797s1c1
Sequence:CCGGCTAGGCTATATGCCATGAATACTCGAGTATTCATGGCATATAGCCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003348.3-773s1c1
Sequence:CCGGCCATAGAAACAGCTAGAGCATCTCGAGATGCTCTAGCTGTTTCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003348
VALIDATED
UBE2N MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2N
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003348.3-606s21c1
Sequence:CCGGAGACAAGTTGGGAAGAATATGCTCGAGCATATTCTTCCCAACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_003348.3-537s21c1
Sequence:CCGGCCTTCCAGAAGAATACCCAATCTCGAGATTGGGTATTCTTCTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003348.3-694s21c1
Sequence:CCGGGCCTTGTTAAGTGCTCCCAATCTCGAGATTGGGAGCACTTAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003348.3-434s21c1
Sequence:CCGGTCAAAGCCGAACCAGATGAGACTCGAGTCTCATCTGGTTCGGCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003348.3-773s21c1
Sequence:CCGGCCATAGAAACAGCTAGAGCATCTCGAGATGCTCTAGCTGTTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003348.3-2012s1c1
Sequence:CCGGGCTGAGGCATTTGTGAGTCTTCTCGAGAAGACTCACAAATGCCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003348.3-694s1c1
Sequence:CCGGGCCTTGTTAAGTGCTCCCAATCTCGAGATTGGGAGCACTTAACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003348.3-797s1c1
Sequence:CCGGCTAGGCTATATGCCATGAATACTCGAGTATTCATGGCATATAGCCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003348.3-773s1c1
Sequence:CCGGCCATAGAAACAGCTAGAGCATCTCGAGATGCTCTAGCTGTTTCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080560
VALIDATED
UBE2N MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2N
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080560.3-401s21c1
Sequence:CCGGGATCCATTAGCAAATGATGTACTCGAGTACATCATTTGCTAATGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080560.3-283s21c1
Sequence:CCGGTGTAGACAAGTTGGGAAGAATCTCGAGATTCTTCCCAACTTGTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080560.3-958s21c1
Sequence:CCGGCTCTAGCCAAGTCTAACTTTACTCGAGTAAAGTTAGACTTGGCTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080560.3-468s21c1
Sequence:CCGGGAGCATGGACTAGGCTATATGCTCGAGCATATAGCCTAGTCCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080560.3-130s21c1
Sequence:CCGGTGAGAGCAACGCCCGTTATTTCTCGAGAAATAACGGGCGTTGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080560.2-401s1c1
Sequence:CCGGGATCCATTAGCAAATGATGTACTCGAGTACATCATTTGCTAATGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080560.2-283s1c1
Sequence:CCGGTGTAGACAAGTTGGGAAGAATCTCGAGATTCTTCCCAACTTGTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080560.2-96s1c1
Sequence:CCGGCAGAACCAGTTCCTGGCATTACTCGAGTAATGCCAGGAACTGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080560.2-241s1c1
Sequence:CCGGAGCACCTAAAGTACGTTTCATCTCGAGATGAAACGTACTTTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080560.2-107s1c1
Sequence:CCGGCCTGGCATTAAAGCAGAACCACTCGAGTGGTTCTGCTTTAATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080560
VALIDATED
UBE2N MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2N
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080560.3-401s21c1
Sequence:CCGGGATCCATTAGCAAATGATGTACTCGAGTACATCATTTGCTAATGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080560.3-283s21c1
Sequence:CCGGTGTAGACAAGTTGGGAAGAATCTCGAGATTCTTCCCAACTTGTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080560.3-958s21c1
Sequence:CCGGCTCTAGCCAAGTCTAACTTTACTCGAGTAAAGTTAGACTTGGCTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080560.3-468s21c1
Sequence:CCGGGAGCATGGACTAGGCTATATGCTCGAGCATATAGCCTAGTCCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080560.3-130s21c1
Sequence:CCGGTGAGAGCAACGCCCGTTATTTCTCGAGAAATAACGGGCGTTGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080560.2-401s1c1
Sequence:CCGGGATCCATTAGCAAATGATGTACTCGAGTACATCATTTGCTAATGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080560.2-283s1c1
Sequence:CCGGTGTAGACAAGTTGGGAAGAATCTCGAGATTCTTCCCAACTTGTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080560.2-96s1c1
Sequence:CCGGCAGAACCAGTTCCTGGCATTACTCGAGTAATGCCAGGAACTGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080560.2-241s1c1
Sequence:CCGGAGCACCTAAAGTACGTTTCATCTCGAGATGAAACGTACTTTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080560.2-107s1c1
Sequence:CCGGCCTGGCATTAAAGCAGAACCACTCGAGTGGTTCTGCTTTAATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080560
VALIDATED
UBE2N MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2N
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080560.3-401s21c1
Sequence:CCGGGATCCATTAGCAAATGATGTACTCGAGTACATCATTTGCTAATGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080560.3-283s21c1
Sequence:CCGGTGTAGACAAGTTGGGAAGAATCTCGAGATTCTTCCCAACTTGTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080560.3-958s21c1
Sequence:CCGGCTCTAGCCAAGTCTAACTTTACTCGAGTAAAGTTAGACTTGGCTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080560.3-468s21c1
Sequence:CCGGGAGCATGGACTAGGCTATATGCTCGAGCATATAGCCTAGTCCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080560.3-130s21c1
Sequence:CCGGTGAGAGCAACGCCCGTTATTTCTCGAGAAATAACGGGCGTTGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080560.2-401s1c1
Sequence:CCGGGATCCATTAGCAAATGATGTACTCGAGTACATCATTTGCTAATGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080560.2-283s1c1
Sequence:CCGGTGTAGACAAGTTGGGAAGAATCTCGAGATTCTTCCCAACTTGTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080560.2-96s1c1
Sequence:CCGGCAGAACCAGTTCCTGGCATTACTCGAGTAATGCCAGGAACTGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080560.2-241s1c1
Sequence:CCGGAGCACCTAAAGTACGTTTCATCTCGAGATGAAACGTACTTTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080560.2-107s1c1
Sequence:CCGGCCTGGCATTAAAGCAGAACCACTCGAGTGGTTCTGCTTTAATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks