EMAIL THIS PAGE TO A FRIEND

UBE2NL

ubiquitin-conjugating enzyme E2N-like

Synonyms: Li174
UniProtKB ID: Q5JXB2, E9KL27
Gene ID:
Human(389898) Summary: This gene is intronless and encodes a member of the ubiquitin-conjugating enzyme family. The protein product is 91% identical to ubiquitin-conjugating enzyme E2N, a multi-exon gene product. [provided by RefSeq, Dec 2009]
Mouse(620934) ubiquitin-conjugating enzyme E2N-like
dog(610206) ubiquitin-conjugating enzyme E2N-like
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301303 ANTI-UBE2NL (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012989 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012989 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012989 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128811 MISSION® esiRNA esiRNA human UBE2NL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012989 Rosetta Predictions human pricing
XM_885442 Rosetta Predictions mouse pricing
XM_905142 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199377 predicted 476
2 SASI_Hs01_00199378 predicted 498
3 SASI_Hs01_00199379 predicted 596
4 SASI_Hs01_00199380 predicted 608
5 SASI_Hs01_00199382 predicted 266
6 SASI_Hs01_00199383 predicted 268
7 SASI_Hs01_00199381 predicted 265
8 SASI_Hs01_00199384 predicted 691
9 SASI_Hs01_00199385 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_885442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282682 predicted 431
2 SASI_Mm01_00282683 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431530 predicted 425
2 SASI_Mm02_00431531 predicted 564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012989
VALIDATED
UBE2NL MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2N-like
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012989.1-440s1c1
Sequence:CCGGCCATTGAAACAGCTAGAGCATCTCGAGATGCTCTAGCTGTTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012989.1-760s1c1
Sequence:CCGGCCCATCCTGGTTTAAGTATAACTCGAGTTATACTTAAACCAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012989.1-782s1c1
Sequence:CCGGGCACTGTGAATGAAGGTAGTTCTCGAGAACTACCTTCATTCACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012989.1-112s1c1
Sequence:CCGGGATGAAAGCAACGCCCGTTATCTCGAGATAACGGGCGTTGCTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012989.1-88s1c1
Sequence:CCGGGTTCCTGGCATCAAAGCAGAACTCGAGTTCTGCTTTGATGCCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012989.1-208s1c1
Sequence:CCGGGCAGAAGAATACCCAATGGCACTCGAGTGCCATTGGGTATTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-351s21c1
Sequence:CCGGATCGATCCAGGCCTTGTTAAACTCGAGTTTAACAAGGCCTGGATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-376s21c1
Sequence:CCGGCCCAATCCAGATGATCCATTACTCGAGTAATGGATCATCTGGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-273s21c1
Sequence:CCGGAGACAAGTTGGAAAGAATAAGCTCGAGCTTATTCTTTCCAACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012989.1-600s21c1
Sequence:CCGGACCCAGACATCTTCAGTTATTCTCGAGAATAACTGAAGATGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-265s21c1
Sequence:CCGGCCAAATGTAGACAAGTTGGAACTCGAGTTCCAACTTGTCTACATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-98s21c1
Sequence:CCGGTCAAAGCAGAACCAGATGAAACTCGAGTTTCATCTGGTTCTGCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-188s21c1
Sequence:CCGGTTAAACGTGAACTATTACTTGCTCGAGCAAGTAATAGTTCACGTTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012989.1-956s21c1
Sequence:CCGGTGCTCTCTATCCAAGTCTAACCTCGAGGTTAGACTTGGATAGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-469s21c1
Sequence:CCGGCTATATGCCATGAATAGTATTCTCGAGAATACTATTCATGGCATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012989
VALIDATED
UBE2NL MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2N-like
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012989.1-440s1c1
Sequence:CCGGCCATTGAAACAGCTAGAGCATCTCGAGATGCTCTAGCTGTTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012989.1-760s1c1
Sequence:CCGGCCCATCCTGGTTTAAGTATAACTCGAGTTATACTTAAACCAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012989.1-782s1c1
Sequence:CCGGGCACTGTGAATGAAGGTAGTTCTCGAGAACTACCTTCATTCACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012989.1-112s1c1
Sequence:CCGGGATGAAAGCAACGCCCGTTATCTCGAGATAACGGGCGTTGCTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012989.1-88s1c1
Sequence:CCGGGTTCCTGGCATCAAAGCAGAACTCGAGTTCTGCTTTGATGCCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012989.1-208s1c1
Sequence:CCGGGCAGAAGAATACCCAATGGCACTCGAGTGCCATTGGGTATTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-351s21c1
Sequence:CCGGATCGATCCAGGCCTTGTTAAACTCGAGTTTAACAAGGCCTGGATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-376s21c1
Sequence:CCGGCCCAATCCAGATGATCCATTACTCGAGTAATGGATCATCTGGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-273s21c1
Sequence:CCGGAGACAAGTTGGAAAGAATAAGCTCGAGCTTATTCTTTCCAACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012989.1-600s21c1
Sequence:CCGGACCCAGACATCTTCAGTTATTCTCGAGAATAACTGAAGATGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-265s21c1
Sequence:CCGGCCAAATGTAGACAAGTTGGAACTCGAGTTCCAACTTGTCTACATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-98s21c1
Sequence:CCGGTCAAAGCAGAACCAGATGAAACTCGAGTTTCATCTGGTTCTGCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-188s21c1
Sequence:CCGGTTAAACGTGAACTATTACTTGCTCGAGCAAGTAATAGTTCACGTTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012989.1-956s21c1
Sequence:CCGGTGCTCTCTATCCAAGTCTAACCTCGAGGTTAGACTTGGATAGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-469s21c1
Sequence:CCGGCTATATGCCATGAATAGTATTCTCGAGAATACTATTCATGGCATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012989
VALIDATED
UBE2NL MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2N-like
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012989.1-440s1c1
Sequence:CCGGCCATTGAAACAGCTAGAGCATCTCGAGATGCTCTAGCTGTTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012989.1-760s1c1
Sequence:CCGGCCCATCCTGGTTTAAGTATAACTCGAGTTATACTTAAACCAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012989.1-782s1c1
Sequence:CCGGGCACTGTGAATGAAGGTAGTTCTCGAGAACTACCTTCATTCACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012989.1-112s1c1
Sequence:CCGGGATGAAAGCAACGCCCGTTATCTCGAGATAACGGGCGTTGCTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012989.1-88s1c1
Sequence:CCGGGTTCCTGGCATCAAAGCAGAACTCGAGTTCTGCTTTGATGCCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012989.1-208s1c1
Sequence:CCGGGCAGAAGAATACCCAATGGCACTCGAGTGCCATTGGGTATTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-351s21c1
Sequence:CCGGATCGATCCAGGCCTTGTTAAACTCGAGTTTAACAAGGCCTGGATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-376s21c1
Sequence:CCGGCCCAATCCAGATGATCCATTACTCGAGTAATGGATCATCTGGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-273s21c1
Sequence:CCGGAGACAAGTTGGAAAGAATAAGCTCGAGCTTATTCTTTCCAACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012989.1-600s21c1
Sequence:CCGGACCCAGACATCTTCAGTTATTCTCGAGAATAACTGAAGATGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-265s21c1
Sequence:CCGGCCAAATGTAGACAAGTTGGAACTCGAGTTCCAACTTGTCTACATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-98s21c1
Sequence:CCGGTCAAAGCAGAACCAGATGAAACTCGAGTTTCATCTGGTTCTGCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-188s21c1
Sequence:CCGGTTAAACGTGAACTATTACTTGCTCGAGCAAGTAATAGTTCACGTTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012989.1-956s21c1
Sequence:CCGGTGCTCTCTATCCAAGTCTAACCTCGAGGTTAGACTTGGATAGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012989.1-469s21c1
Sequence:CCGGCTATATGCCATGAATAGTATTCTCGAGAATACTATTCATGGCATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks