EMAIL THIS PAGE TO A FRIEND

UBE2O

ubiquitin-conjugating enzyme E2O

Synonyms: E2-230K
Gene ID:
Mouse(217342) ubiquitin-conjugating enzyme E2O
Rat(303689) ubiquitin-conjugating enzyme E2O
chicken(417359) ubiquitin-conjugating enzyme E2O
domestic cat(101097933) ubiquitin-conjugating enzyme E2O
dog(483330) ubiquitin-conjugating enzyme E2O
cow(789422) ubiquitin-conjugating enzyme E2O
sheep(101116847) ubiquitin-conjugating enzyme E2O
domestic guinea pig(100723966) ubiquitin-conjugating enzyme E2O
naked mole-rat(101713045) ubiquitin-conjugating enzyme E2O
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173755 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173755 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173755 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022066 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022066 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022066 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022066 Rosetta Predictions human pricing
XM_001081723 Rosetta Predictions rat pricing
XM_221132 Rosetta Predictions rat pricing
NM_173755 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037229 predicted 1821
2 SASI_Hs01_00037230 predicted 2025
3 SASI_Hs01_00037231 predicted 983
4 SASI_Hs01_00037232 predicted 971
5 SASI_Hs01_00037233 predicted 1276
6 SASI_Hs01_00037234 predicted 2197
7 SASI_Hs01_00037235 predicted 2140
8 SASI_Hs01_00037236 predicted 811
9 SASI_Hs01_00037237 predicted 480
10 SASI_Hs01_00037238 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081723 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373175 predicted 3343
2 SASI_Rn02_00373176 predicted 655
3 SASI_Rn02_00373177 predicted 3269
4 SASI_Rn02_00373178 predicted 2535
5 SASI_Rn02_00373179 predicted 710
6 SASI_Rn02_00373180 predicted 2016
7 SASI_Rn02_00373181 predicted 1973
8 SASI_Rn02_00373182 predicted 2279
9 SASI_Rn02_00373183 predicted 1807
10 SASI_Rn02_00373184 predicted 3158
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379894 predicted 3349
2 SASI_Rn02_00379895 predicted 661
3 SASI_Rn02_00379896 predicted 3277
4 SASI_Rn02_00379897 predicted 2541
5 SASI_Rn02_00379898 predicted 713
6 SASI_Rn02_00379899 predicted 2028
7 SASI_Rn02_00379900 predicted 1978
8 SASI_Rn02_00379901 predicted 2290
9 SASI_Rn02_00379902 predicted 1824
10 SASI_Rn02_00379903 predicted 3160
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055916 predicted 614
2 SASI_Mm01_00055917 predicted 3246
3 SASI_Mm01_00055918 predicted 2931
4 SASI_Mm01_00055919 predicted 509
5 SASI_Mm01_00055920 predicted 3890
6 SASI_Mm02_00345400 predicted 1163
7 SASI_Mm01_00055921 predicted 3242
8 SASI_Mm01_00055922 predicted 3113
9 SASI_Mm01_00055923 predicted 1452
10 SASI_Mm01_00055924 predicted 1982
11 SASI_Mm01_00055925 predicted 2117
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173755
VALIDATED
UBE2O MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2O
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173755.3-1181s21c1
Sequence:CCGGCGTCTGTTGAAGAAGCAAGTTCTCGAGAACTTGCTTCTTCAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173755.3-2564s21c1
Sequence:CCGGCCAACCCGAGAGAAGAAGTTTCTCGAGAAACTTCTTCTCTCGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173755.3-608s21c1
Sequence:CCGGCCCTTCATGTATGGAGACTATCTCGAGATAGTCTCCATACATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173755.3-4792s21c1
Sequence:CCGGCCAGAGGTTTACAAGTTTCTACTCGAGTAGAAACTTGTAAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173755.3-2000s21c1
Sequence:CCGGCGCATTGGTAACACGGAGGATCTCGAGATCCTCCGTGTTACCAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173755.3-4792s1c1
Sequence:CCGGCCAGAGGTTTACAAGTTTCTACTCGAGTAGAAACTTGTAAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173755.3-608s1c1
Sequence:CCGGCCCTTCATGTATGGAGACTATCTCGAGATAGTCTCCATACATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173755.3-2564s1c1
Sequence:CCGGCCAACCCGAGAGAAGAAGTTTCTCGAGAAACTTCTTCTCTCGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173755.3-2000s1c1
Sequence:CCGGCGCATTGGTAACACGGAGGATCTCGAGATCCTCCGTGTTACCAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173755.3-1181s1c1
Sequence:CCGGCGTCTGTTGAAGAAGCAAGTTCTCGAGAACTTGCTTCTTCAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173755
VALIDATED
UBE2O MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2O
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173755.3-1181s21c1
Sequence:CCGGCGTCTGTTGAAGAAGCAAGTTCTCGAGAACTTGCTTCTTCAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173755.3-2564s21c1
Sequence:CCGGCCAACCCGAGAGAAGAAGTTTCTCGAGAAACTTCTTCTCTCGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173755.3-608s21c1
Sequence:CCGGCCCTTCATGTATGGAGACTATCTCGAGATAGTCTCCATACATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173755.3-4792s21c1
Sequence:CCGGCCAGAGGTTTACAAGTTTCTACTCGAGTAGAAACTTGTAAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173755.3-2000s21c1
Sequence:CCGGCGCATTGGTAACACGGAGGATCTCGAGATCCTCCGTGTTACCAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173755.3-4792s1c1
Sequence:CCGGCCAGAGGTTTACAAGTTTCTACTCGAGTAGAAACTTGTAAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173755.3-608s1c1
Sequence:CCGGCCCTTCATGTATGGAGACTATCTCGAGATAGTCTCCATACATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173755.3-2564s1c1
Sequence:CCGGCCAACCCGAGAGAAGAAGTTTCTCGAGAAACTTCTTCTCTCGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173755.3-2000s1c1
Sequence:CCGGCGCATTGGTAACACGGAGGATCTCGAGATCCTCCGTGTTACCAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173755.3-1181s1c1
Sequence:CCGGCGTCTGTTGAAGAAGCAAGTTCTCGAGAACTTGCTTCTTCAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173755
VALIDATED
UBE2O MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2O
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173755.3-1181s21c1
Sequence:CCGGCGTCTGTTGAAGAAGCAAGTTCTCGAGAACTTGCTTCTTCAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173755.3-2564s21c1
Sequence:CCGGCCAACCCGAGAGAAGAAGTTTCTCGAGAAACTTCTTCTCTCGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173755.3-608s21c1
Sequence:CCGGCCCTTCATGTATGGAGACTATCTCGAGATAGTCTCCATACATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173755.3-4792s21c1
Sequence:CCGGCCAGAGGTTTACAAGTTTCTACTCGAGTAGAAACTTGTAAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173755.3-2000s21c1
Sequence:CCGGCGCATTGGTAACACGGAGGATCTCGAGATCCTCCGTGTTACCAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173755.3-4792s1c1
Sequence:CCGGCCAGAGGTTTACAAGTTTCTACTCGAGTAGAAACTTGTAAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173755.3-608s1c1
Sequence:CCGGCCCTTCATGTATGGAGACTATCTCGAGATAGTCTCCATACATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173755.3-2564s1c1
Sequence:CCGGCCAACCCGAGAGAAGAAGTTTCTCGAGAAACTTCTTCTCTCGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173755.3-2000s1c1
Sequence:CCGGCGCATTGGTAACACGGAGGATCTCGAGATCCTCCGTGTTACCAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173755.3-1181s1c1
Sequence:CCGGCGTCTGTTGAAGAAGCAAGTTCTCGAGAACTTGCTTCTTCAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022066
VALIDATED
UBE2O MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2O
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022066.3-827s21c1
Sequence:CCGGCGATGATTCCTATGGCTTCTACTCGAGTAGAAGCCATAGGAATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022066.3-1981s21c1
Sequence:CCGGATGTGAGTGTTTACGACATTGCTCGAGCAATGTCGTAAACACTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022066.3-814s21c1
Sequence:CCGGCGGGTCTCTTCTTCGATGATTCTCGAGAATCATCGAAGAAGAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272906    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022066.3-4173s21c1
Sequence:CCGGTCGGAACCCTGTTGCCGATTTCTCGAGAAATCGGCAACAGGGTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022066.3-2038s21c1
Sequence:CCGGTCGTCATCCGCATCGGCAATACTCGAGTATTGCCGATGCGGATGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022066.x-827s1c1
Sequence:CCGGCGATGATTCCTATGGCTTCTACTCGAGTAGAAGCCATAGGAATCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022066.x-2631s1c1
Sequence:CCGGGACATCAAGAAGCTACAGGAACTCGAGTTCCTGTAGCTTCTTGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022066.x-4103s1c1
Sequence:CCGGTGTGTTGAGATGCTGCCGTTTCTCGAGAAACGGCAGCATCTCAACACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022066.x-814s1c1
Sequence:CCGGCGGGTCTCTTCTTCGATGATTCTCGAGAATCATCGAAGAAGAGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022066.x-3851s1c1
Sequence:CCGGCAAGGGTTTCATCAAGAGCATCTCGAGATGCTCTTGATGAAACCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022066
VALIDATED
UBE2O MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2O
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022066.3-827s21c1
Sequence:CCGGCGATGATTCCTATGGCTTCTACTCGAGTAGAAGCCATAGGAATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022066.3-1981s21c1
Sequence:CCGGATGTGAGTGTTTACGACATTGCTCGAGCAATGTCGTAAACACTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022066.3-814s21c1
Sequence:CCGGCGGGTCTCTTCTTCGATGATTCTCGAGAATCATCGAAGAAGAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272906    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022066.3-4173s21c1
Sequence:CCGGTCGGAACCCTGTTGCCGATTTCTCGAGAAATCGGCAACAGGGTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022066.3-2038s21c1
Sequence:CCGGTCGTCATCCGCATCGGCAATACTCGAGTATTGCCGATGCGGATGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022066.x-827s1c1
Sequence:CCGGCGATGATTCCTATGGCTTCTACTCGAGTAGAAGCCATAGGAATCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022066.x-2631s1c1
Sequence:CCGGGACATCAAGAAGCTACAGGAACTCGAGTTCCTGTAGCTTCTTGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022066.x-4103s1c1
Sequence:CCGGTGTGTTGAGATGCTGCCGTTTCTCGAGAAACGGCAGCATCTCAACACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022066.x-814s1c1
Sequence:CCGGCGGGTCTCTTCTTCGATGATTCTCGAGAATCATCGAAGAAGAGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022066.x-3851s1c1
Sequence:CCGGCAAGGGTTTCATCAAGAGCATCTCGAGATGCTCTTGATGAAACCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022066
VALIDATED
UBE2O MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2O
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022066.3-827s21c1
Sequence:CCGGCGATGATTCCTATGGCTTCTACTCGAGTAGAAGCCATAGGAATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022066.3-1981s21c1
Sequence:CCGGATGTGAGTGTTTACGACATTGCTCGAGCAATGTCGTAAACACTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022066.3-814s21c1
Sequence:CCGGCGGGTCTCTTCTTCGATGATTCTCGAGAATCATCGAAGAAGAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272906    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022066.3-4173s21c1
Sequence:CCGGTCGGAACCCTGTTGCCGATTTCTCGAGAAATCGGCAACAGGGTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022066.3-2038s21c1
Sequence:CCGGTCGTCATCCGCATCGGCAATACTCGAGTATTGCCGATGCGGATGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022066.x-827s1c1
Sequence:CCGGCGATGATTCCTATGGCTTCTACTCGAGTAGAAGCCATAGGAATCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022066.x-2631s1c1
Sequence:CCGGGACATCAAGAAGCTACAGGAACTCGAGTTCCTGTAGCTTCTTGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022066.x-4103s1c1
Sequence:CCGGTGTGTTGAGATGCTGCCGTTTCTCGAGAAACGGCAGCATCTCAACACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022066.x-814s1c1
Sequence:CCGGCGGGTCTCTTCTTCGATGATTCTCGAGAATCATCGAAGAAGAGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022066.x-3851s1c1
Sequence:CCGGCAAGGGTTTCATCAAGAGCATCTCGAGATGCTCTTGATGAAACCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks