EMAIL THIS PAGE TO A FRIEND

UBE2Q1

ubiquitin-conjugating enzyme E2Q family member 1

Synonyms: GTAP NICE-5 UBE2Q
Gene ID:
Human(55585) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes (E1s), ubiquitin-conjugating enzymes (E2s), and ubiquitin-protein ligases (E3s). This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein is 98% identical to the mouse counterpart. [provided by RefSeq, Jul 2008]
Mouse(70093) ubiquitin-conjugating enzyme E2Q (putative) 1
Rat(295252) ubiquitin-conjugating enzyme E2Q family member 1
naked mole-rat(101723479) ubiquitin-conjugating enzyme E2Q family member 1
domestic guinea pig(100732687) ubiquitin-conjugating enzyme E2Q family member 1
cow(505133) ubiquitin-conjugating enzyme E2Q family member 1
sheep(101112363) ubiquitin-conjugating enzyme E2Q family member 1
Zebrafish(553603) ubiquitin-conjugating enzyme E2Q (putative) 1
domestic cat(101085178) ubiquitin-conjugating enzyme E2Q family member 1
Horse(100062653) ubiquitin-conjugating enzyme E2Q family member 1
dog(100688676) ubiquitin-conjugating enzyme E2Q family member 1
152 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017582 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017582 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017582 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027315 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027315 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027315 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017582 Rosetta Predictions human pricing
NM_001106448 Rosetta Predictions rat pricing
NM_027315 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241781 predicted 936
2 SASI_Hs01_00241782 predicted 936
3 SASI_Hs01_00241783 predicted 1141
4 SASI_Hs01_00241784 predicted 1238
5 SASI_Hs02_00350246 predicted 884
6 SASI_Hs02_00350247 predicted 1023
7 SASI_Hs01_00241786 predicted 886
8 SASI_Hs01_00241787 predicted 1287
9 SASI_Hs01_00241788 predicted 1072
10 SASI_Hs01_00241790 predicted 1266
11 SASI_Hs01_00241785 predicted 1257
12 SASI_Hs01_00241789 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106448 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219058 predicted 542
2 SASI_Rn02_00219059 predicted 928
3 SASI_Rn02_00219060 predicted 740
4 SASI_Rn02_00219061 predicted 655
5 SASI_Rn02_00219062 predicted 497
6 SASI_Rn02_00219063 predicted 510
7 SASI_Rn02_00219064 predicted 1269
8 SASI_Rn02_00219065 predicted 985
9 SASI_Rn02_00219066 predicted 399
10 SASI_Rn02_00219067 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027315 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140687 predicted 552
2 SASI_Mm01_00140688 predicted 1406
3 SASI_Mm01_00140690 predicted 944
4 SASI_Mm02_00331939 predicted 674
5 SASI_Mm01_00140691 predicted 647
6 SASI_Mm01_00140692 predicted 1040
7 SASI_Mm01_00140694 predicted 1249
8 SASI_Mm02_00331940 predicted 507
9 SASI_Mm01_00140693 predicted 521
10 SASI_Mm01_00140696 predicted 695
11 SASI_Mm01_00140689 predicted 469
12 SASI_Mm01_00140695 predicted 502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017582
VALIDATED
UBE2Q1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2Q family member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017582.x-698s1c1
Sequence:CCGGCACTATGAAATGAAAGAGGAACTCGAGTTCCTCTTTCATTTCATAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017582.x-1026s1c1
Sequence:CCGGCCGACTTCATTCTACTTAACTCTCGAGAGTTAAGTAGAATGAAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017582.x-1253s1c1
Sequence:CCGGGCCAACAAATCTCAATACAGTCTCGAGACTGTATTGAGATTTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017582.x-552s1c1
Sequence:CCGGCCGACCTGTGTAAACTCTATACTCGAGTATAGAGTTTACACAGGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017582.6-552s21c1
Sequence:CCGGCCGACCTGTGTAAACTCTATACTCGAGTATAGAGTTTACACAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017582.6-1026s21c1
Sequence:CCGGCCGACTTCATTCTACTTAACTCTCGAGAGTTAAGTAGAATGAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017582.6-1253s21c1
Sequence:CCGGGCCAACAAATCTCAATACAGTCTCGAGACTGTATTGAGATTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017582.6-3002s21c1
Sequence:CCGGGTTGAGATAAAGACGGGACATCTCGAGATGTCCCGTCTTTATCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017582
VALIDATED
UBE2Q1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2Q family member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017582.x-698s1c1
Sequence:CCGGCACTATGAAATGAAAGAGGAACTCGAGTTCCTCTTTCATTTCATAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017582.x-1026s1c1
Sequence:CCGGCCGACTTCATTCTACTTAACTCTCGAGAGTTAAGTAGAATGAAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017582.x-1253s1c1
Sequence:CCGGGCCAACAAATCTCAATACAGTCTCGAGACTGTATTGAGATTTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017582.x-552s1c1
Sequence:CCGGCCGACCTGTGTAAACTCTATACTCGAGTATAGAGTTTACACAGGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017582.6-552s21c1
Sequence:CCGGCCGACCTGTGTAAACTCTATACTCGAGTATAGAGTTTACACAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017582.6-1026s21c1
Sequence:CCGGCCGACTTCATTCTACTTAACTCTCGAGAGTTAAGTAGAATGAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017582.6-1253s21c1
Sequence:CCGGGCCAACAAATCTCAATACAGTCTCGAGACTGTATTGAGATTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017582.6-3002s21c1
Sequence:CCGGGTTGAGATAAAGACGGGACATCTCGAGATGTCCCGTCTTTATCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017582
VALIDATED
UBE2Q1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2Q family member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017582.x-698s1c1
Sequence:CCGGCACTATGAAATGAAAGAGGAACTCGAGTTCCTCTTTCATTTCATAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017582.x-1026s1c1
Sequence:CCGGCCGACTTCATTCTACTTAACTCTCGAGAGTTAAGTAGAATGAAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017582.x-1253s1c1
Sequence:CCGGGCCAACAAATCTCAATACAGTCTCGAGACTGTATTGAGATTTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017582.x-552s1c1
Sequence:CCGGCCGACCTGTGTAAACTCTATACTCGAGTATAGAGTTTACACAGGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017582.6-552s21c1
Sequence:CCGGCCGACCTGTGTAAACTCTATACTCGAGTATAGAGTTTACACAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017582.6-1026s21c1
Sequence:CCGGCCGACTTCATTCTACTTAACTCTCGAGAGTTAAGTAGAATGAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017582.6-1253s21c1
Sequence:CCGGGCCAACAAATCTCAATACAGTCTCGAGACTGTATTGAGATTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017582.6-3002s21c1
Sequence:CCGGGTTGAGATAAAGACGGGACATCTCGAGATGTCCCGTCTTTATCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027315
UBE2Q1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2Q family member 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027315.2-1041s1c1
Sequence:CCGGCCTACTTAACTTCTCCTTTAACTCGAGTTAAAGGAGAAGTTAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027315.4-1641s21c1
Sequence:CCGGACTCTCAAGCCTCCTTATATTCTCGAGAATATAAGGAGGCTTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027315.4-873s21c1
Sequence:CCGGTGAAGGAGCTCAGGGATATATCTCGAGATATATCCCTGAGCTCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027315.4-700s21c1
Sequence:CCGGAGACCTAGATCACTATGAAATCTCGAGATTTCATAGTGATCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027315.4-1036s21c1
Sequence:CCGGAGCAGACTTCATCCTACTTAACTCGAGTTAAGTAGGATGAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027315.4-810s21c1
Sequence:CCGGACCAGAGGCAAGATTACTTAACTCGAGTTAAGTAATCTTGCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027315
UBE2Q1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2Q family member 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027315.2-1041s1c1
Sequence:CCGGCCTACTTAACTTCTCCTTTAACTCGAGTTAAAGGAGAAGTTAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027315.4-1641s21c1
Sequence:CCGGACTCTCAAGCCTCCTTATATTCTCGAGAATATAAGGAGGCTTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027315.4-873s21c1
Sequence:CCGGTGAAGGAGCTCAGGGATATATCTCGAGATATATCCCTGAGCTCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027315.4-700s21c1
Sequence:CCGGAGACCTAGATCACTATGAAATCTCGAGATTTCATAGTGATCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027315.4-1036s21c1
Sequence:CCGGAGCAGACTTCATCCTACTTAACTCGAGTTAAGTAGGATGAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027315.4-810s21c1
Sequence:CCGGACCAGAGGCAAGATTACTTAACTCGAGTTAAGTAATCTTGCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027315
UBE2Q1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2Q family member 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027315.2-1041s1c1
Sequence:CCGGCCTACTTAACTTCTCCTTTAACTCGAGTTAAAGGAGAAGTTAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027315.4-1641s21c1
Sequence:CCGGACTCTCAAGCCTCCTTATATTCTCGAGAATATAAGGAGGCTTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027315.4-873s21c1
Sequence:CCGGTGAAGGAGCTCAGGGATATATCTCGAGATATATCCCTGAGCTCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027315.4-700s21c1
Sequence:CCGGAGACCTAGATCACTATGAAATCTCGAGATTTCATAGTGATCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027315.4-1036s21c1
Sequence:CCGGAGCAGACTTCATCCTACTTAACTCGAGTTAAGTAGGATGAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027315.4-810s21c1
Sequence:CCGGACCAGAGGCAAGATTACTTAACTCGAGTTAAGTAATCTTGCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks