EMAIL THIS PAGE TO A FRIEND

UBE2Q2

ubiquitin-conjugating enzyme E2Q family member 2

UniProtKB ID: Q8WVN8, B7Z3Q2, H3BRG2, Q8N4G6, Q96J08
Gene ID:
Mouse(109161) ubiquitin-conjugating enzyme E2Q (putative) 2
Rat(363065) ubiquitin-conjugating enzyme E2Q family member 2
Zebrafish(406260) ubiquitin-conjugating enzyme E2Q family member 2
chicken(415356) ubiquitin-conjugating enzyme E2Q family member 2
Horse(100050645) ubiquitin-conjugating enzyme E2Q family member 2
domestic cat(101094600) ubiquitin-conjugating enzyme E2Q family member 2
dog(478374) ubiquitin-conjugating enzyme E2Q family member 2
cow(511631) ubiquitin-conjugating enzyme E2Q family member 2
sheep(101101924) ubiquitin-conjugating enzyme E2Q family member 2
domestic guinea pig(100721764) ubiquitin-conjugating enzyme E2Q family member 2
naked mole-rat(101696886) ubiquitin-conjugating enzyme E2Q family member 2
Domestic Rabbit(100009425) ubiquitin-conjugating enzyme E2Q family member 2
156 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173469 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173469 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173469 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_180600 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_180600 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_180600 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173469 Rosetta Predictions human pricing
XM_001072896 Rosetta Predictions rat pricing
XM_343393 Rosetta Predictions rat pricing
NM_180600 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128047 predicted 1330
2 SASI_Hs01_00128048 predicted 1064
3 SASI_Hs01_00128049 predicted 1339
4 SASI_Hs01_00128050 predicted 1172
5 SASI_Hs01_00128051 predicted 1214
6 SASI_Hs02_00368214 predicted 1109
7 SASI_Hs01_00128053 predicted 1048
8 SASI_Hs01_00128054 predicted 1228
9 SASI_Hs01_00128055 predicted 906
10 SASI_Hs01_00128056 predicted 878
11 SASI_Hs01_00128052 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340843 predicted 1867
2 SASI_Rn02_00340844 predicted 1319
3 SASI_Rn02_00340845 predicted 1239
4 SASI_Rn02_00340846 predicted 1168
5 SASI_Rn02_00340847 predicted 1675
6 SASI_Rn02_00340848 predicted 1886
7 SASI_Rn02_00340849 predicted 1872
8 SASI_Rn02_00340850 predicted 1668
9 SASI_Rn02_00340851 predicted 1773
10 SASI_Rn02_00340852 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343393 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125064 predicted 2002
2 SASI_Rn01_00125065 predicted 454
3 SASI_Rn01_00125066 predicted 1894
4 SASI_Rn01_00125067 predicted 551
5 SASI_Rn01_00125068 predicted 1820
6 SASI_Rn01_00125069 predicted 1739
7 SASI_Rn01_00125070 predicted 271
8 SASI_Rn01_00125071 predicted 413
9 SASI_Rn01_00125072 predicted 464
10 SASI_Rn01_00125073 predicted 1846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_180600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349579 predicted 1024
2 SASI_Mm01_00149208 predicted 1119
3 SASI_Mm01_00149209 predicted 1487
4 SASI_Mm01_00149210 predicted 1323
5 SASI_Mm01_00149211 predicted 1463
6 SASI_Mm01_00149212 predicted 1276
7 SASI_Mm02_00349580 predicted 584
8 SASI_Mm01_00149213 predicted 1168
9 SASI_Mm01_00149214 predicted 469
10 SASI_Mm01_00149215 predicted 567
11 SASI_Mm01_00149207 predicted 1291
12 SASI_Mm01_00149216 predicted 587
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173469
VALIDATED
UBE2Q2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2Q family member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173469.2-648s21c1
Sequence:CCGGGATACTAAGAACAACAATTTGCTCGAGCAAATTGTTGTTCTTAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173469.2-995s21c1
Sequence:CCGGGCAAGCTTCAGATAGACTTATCTCGAGATAAGTCTATCTGAAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173469.2-1346s21c1
Sequence:CCGGATCGGTCATCATGCAAATAAACTCGAGTTTATTTGCATGATGACCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173469.2-2012s21c1
Sequence:CCGGTGATAGGAAACCTACTCATTACTCGAGTAATGAGTAGGTTTCCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173469.2-1034s21c1
Sequence:CCGGATACAGATCACAGAGTTATAACTCGAGTTATAACTCTGTGATCTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173469.1-2171s1c1
Sequence:CCGGGCACAAAGACTCCTTGAGCAACTCGAGTTGCTCAAGGAGTCTTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173469.1-1055s1c1
Sequence:CCGGCCATTTGTTCGAGTGGTGTTACTCGAGTAACACCACTCGAACAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173469.1-554s1c1
Sequence:CCGGCTGGATGTTGAGATGCTAGATCTCGAGATCTAGCATCTCAACATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173469.1-1190s1c1
Sequence:CCGGGCCACCTTAGTCAAAGGCAAACTCGAGTTTGCCTTTGACTAAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173469.1-1257s1c1
Sequence:CCGGGAGCCCAACAATCCTATAATTCTCGAGAATTATAGGATTGTTGGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173469
VALIDATED
UBE2Q2 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2Q family member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173469.2-648s21c1
Sequence:CCGGGATACTAAGAACAACAATTTGCTCGAGCAAATTGTTGTTCTTAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173469.2-995s21c1
Sequence:CCGGGCAAGCTTCAGATAGACTTATCTCGAGATAAGTCTATCTGAAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173469.2-1346s21c1
Sequence:CCGGATCGGTCATCATGCAAATAAACTCGAGTTTATTTGCATGATGACCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173469.2-2012s21c1
Sequence:CCGGTGATAGGAAACCTACTCATTACTCGAGTAATGAGTAGGTTTCCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173469.2-1034s21c1
Sequence:CCGGATACAGATCACAGAGTTATAACTCGAGTTATAACTCTGTGATCTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173469.1-2171s1c1
Sequence:CCGGGCACAAAGACTCCTTGAGCAACTCGAGTTGCTCAAGGAGTCTTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173469.1-1055s1c1
Sequence:CCGGCCATTTGTTCGAGTGGTGTTACTCGAGTAACACCACTCGAACAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173469.1-554s1c1
Sequence:CCGGCTGGATGTTGAGATGCTAGATCTCGAGATCTAGCATCTCAACATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173469.1-1190s1c1
Sequence:CCGGGCCACCTTAGTCAAAGGCAAACTCGAGTTTGCCTTTGACTAAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173469.1-1257s1c1
Sequence:CCGGGAGCCCAACAATCCTATAATTCTCGAGAATTATAGGATTGTTGGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173469
VALIDATED
UBE2Q2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2Q family member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173469.2-648s21c1
Sequence:CCGGGATACTAAGAACAACAATTTGCTCGAGCAAATTGTTGTTCTTAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173469.2-995s21c1
Sequence:CCGGGCAAGCTTCAGATAGACTTATCTCGAGATAAGTCTATCTGAAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173469.2-1346s21c1
Sequence:CCGGATCGGTCATCATGCAAATAAACTCGAGTTTATTTGCATGATGACCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173469.2-2012s21c1
Sequence:CCGGTGATAGGAAACCTACTCATTACTCGAGTAATGAGTAGGTTTCCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173469.2-1034s21c1
Sequence:CCGGATACAGATCACAGAGTTATAACTCGAGTTATAACTCTGTGATCTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173469.1-2171s1c1
Sequence:CCGGGCACAAAGACTCCTTGAGCAACTCGAGTTGCTCAAGGAGTCTTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173469.1-1055s1c1
Sequence:CCGGCCATTTGTTCGAGTGGTGTTACTCGAGTAACACCACTCGAACAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173469.1-554s1c1
Sequence:CCGGCTGGATGTTGAGATGCTAGATCTCGAGATCTAGCATCTCAACATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173469.1-1190s1c1
Sequence:CCGGGCCACCTTAGTCAAAGGCAAACTCGAGTTTGCCTTTGACTAAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173469.1-1257s1c1
Sequence:CCGGGAGCCCAACAATCCTATAATTCTCGAGAATTATAGGATTGTTGGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_180600
VALIDATED
UBE2Q2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2Q family member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180600.1-1115s1c1
Sequence:CCGGCCGTTTGTTAGAGTGGTGTTACTCGAGTAACACCACTCTAACAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180600.1-1325s1c1
Sequence:CCGGCAGTCCTATAATTCCATTGTACTCGAGTACAATGGAATTATAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180600.1-591s1c1
Sequence:CCGGGCAGATTATATAACCTTCCTACTCGAGTAGGAAGGTTATATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180600.1-1219s1c1
Sequence:CCGGCTCAATAGAATCTGTCATCATCTCGAGATGATGACAGATTCTATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180600.1-450s1c1
Sequence:CCGGCGGAATCTTACCCATCTTCTTCTCGAGAAGAAGATGGGTAAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_180600
VALIDATED
UBE2Q2 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2Q family member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180600.1-1115s1c1
Sequence:CCGGCCGTTTGTTAGAGTGGTGTTACTCGAGTAACACCACTCTAACAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180600.1-1325s1c1
Sequence:CCGGCAGTCCTATAATTCCATTGTACTCGAGTACAATGGAATTATAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180600.1-591s1c1
Sequence:CCGGGCAGATTATATAACCTTCCTACTCGAGTAGGAAGGTTATATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180600.1-1219s1c1
Sequence:CCGGCTCAATAGAATCTGTCATCATCTCGAGATGATGACAGATTCTATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180600.1-450s1c1
Sequence:CCGGCGGAATCTTACCCATCTTCTTCTCGAGAAGAAGATGGGTAAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_180600
VALIDATED
UBE2Q2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2Q family member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180600.1-1115s1c1
Sequence:CCGGCCGTTTGTTAGAGTGGTGTTACTCGAGTAACACCACTCTAACAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180600.1-1325s1c1
Sequence:CCGGCAGTCCTATAATTCCATTGTACTCGAGTACAATGGAATTATAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180600.1-591s1c1
Sequence:CCGGGCAGATTATATAACCTTCCTACTCGAGTAGGAAGGTTATATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180600.1-1219s1c1
Sequence:CCGGCTCAATAGAATCTGTCATCATCTCGAGATGATGACAGATTCTATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_180600.1-450s1c1
Sequence:CCGGCGGAATCTTACCCATCTTCTTCTCGAGAAGAAGATGGGTAAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks