EMAIL THIS PAGE TO A FRIEND

UBE2Q2P1

ubiquitin-conjugating enzyme E2Q family member 2 pseudogene 1

Synonyms: UBE2QP1
Species: Human UBE2Q2P1(388165)
Gene ID:
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207382 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207382 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207382 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207382 Rosetta Predictions human pricing
NR_003661 Rosetta Predictions human pricing
XR_042138 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099027 predicted 1792
2 SASI_Hs01_00099028 predicted 1317
3 SASI_Hs01_00099029 predicted 1297
4 SASI_Hs01_00099030 predicted 1325
5 SASI_Hs01_00099031 predicted 1346
6 SASI_Hs01_00099032 predicted 1135
7 SASI_Hs01_00099033 predicted 1359
8 SASI_Hs01_00099034 predicted 1137
9 SASI_Hs01_00099035 predicted 1692
10 SASI_Hs01_00099036 predicted 1697
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379979 predicted 302
2 SASI_Hs02_00379980 predicted 385
3 SASI_Hs02_00379981 predicted 301
4 SASI_Hs02_00379982 predicted 308
5 SASI_Hs02_00379983 predicted 299
6 SASI_Hs02_00379984 predicted 204
7 SASI_Hs02_00379985 predicted 196
8 SASI_Hs02_00379986 predicted 308
9 SASI_Hs02_00379987 predicted 1792
10 SASI_Hs02_00379988 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533376 predicted 324
2 SASI_Hs02_00533377 predicted 317
3 SASI_Hs02_00533378 predicted 329
4 SASI_Hs02_00533379 predicted 364
5 SASI_Hs02_00533380 predicted 366
6 SASI_Hs02_00533381 predicted 370
7 SASI_Hs02_00533382 predicted 296
8 SASI_Hs02_00533383 predicted 339
9 SASI_Hs02_00533384 predicted 356
10 SASI_Hs02_00533385 predicted 305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207382
UBE2Q2P1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2Q family member 2 pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118492    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207382.1-1794s1c1
Sequence:CCGGCGTAAGTAGATGGCTCTCTTACTCGAGTAAGAGAGCCATCTACTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207382.1-1135s1c1
Sequence:CCGGTGTTCAGCCAATCGTGTTTAACTCGAGTTAAACACGATTGGCTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207382.1-1489s1c1
Sequence:CCGGAGAGCCTACTAGTGAGAAGAACTCGAGTTCTTCTCACTAGTAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207382.1-1492s1c1
Sequence:CCGGGCCTACTAGTGAGAAGAAGTTCTCGAGAACTTCTTCTCACTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207382.1-1479s1c1
Sequence:CCGGAGATGAAAGAAGAGCCTACTACTCGAGTAGTAGGCTCTTCTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207382
UBE2Q2P1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2Q family member 2 pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118492    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207382.1-1794s1c1
Sequence:CCGGCGTAAGTAGATGGCTCTCTTACTCGAGTAAGAGAGCCATCTACTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207382.1-1135s1c1
Sequence:CCGGTGTTCAGCCAATCGTGTTTAACTCGAGTTAAACACGATTGGCTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207382.1-1489s1c1
Sequence:CCGGAGAGCCTACTAGTGAGAAGAACTCGAGTTCTTCTCACTAGTAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207382.1-1492s1c1
Sequence:CCGGGCCTACTAGTGAGAAGAAGTTCTCGAGAACTTCTTCTCACTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207382.1-1479s1c1
Sequence:CCGGAGATGAAAGAAGAGCCTACTACTCGAGTAGTAGGCTCTTCTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207382
UBE2Q2P1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2Q family member 2 pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118492    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207382.1-1794s1c1
Sequence:CCGGCGTAAGTAGATGGCTCTCTTACTCGAGTAAGAGAGCCATCTACTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207382.1-1135s1c1
Sequence:CCGGTGTTCAGCCAATCGTGTTTAACTCGAGTTAAACACGATTGGCTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207382.1-1489s1c1
Sequence:CCGGAGAGCCTACTAGTGAGAAGAACTCGAGTTCTTCTCACTAGTAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207382.1-1492s1c1
Sequence:CCGGGCCTACTAGTGAGAAGAAGTTCTCGAGAACTTCTTCTCACTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207382.1-1479s1c1
Sequence:CCGGAGATGAAAGAAGAGCCTACTACTCGAGTAGTAGGCTCTTCTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks