EMAIL THIS PAGE TO A FRIEND

UBE2QL1

ubiquitin-conjugating enzyme E2Q family-like 1

UniProtKB ID: A1L167
Gene ID:
Mouse(76980) ubiquitin-conjugating enzyme E2Q family-like 1
Rat(679949) ubiquitin-conjugating enzyme E2Q family-like 1
chicken(420939) ubiquitin-conjugating enzyme E2Q family-like 1
dog(488058) ubiquitin-conjugating enzyme E2Q family-like 1
domestic guinea pig(100735700) ubiquitin-conjugating enzyme E2Q family-like 1
naked mole-rat(101714028) ubiquitin-conjugating enzyme E2Q family-like 1
117 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_127466 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127466 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127466 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001145161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145161 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU074851 MISSION® esiRNA esiRNA targeting mouse 3110006E14Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_059689 Rosetta Predictions human pricing
XR_040585 Rosetta Predictions human pricing
XR_040586 Rosetta Predictions human pricing
XM_001055050 Rosetta Predictions rat pricing
XM_127466 Rosetta Predictions mouse pricing
XM_906878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_059689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286407 predicted 773
2 SASI_Hs01_00286408 predicted 949
3 SASI_Hs01_00286409 predicted 1025
4 SASI_Hs01_00286410 predicted 1034
5 SASI_Hs01_00286411 predicted 1029
6 SASI_Hs01_00286412 predicted 1291
7 SASI_Hs01_00286413 predicted 929
8 SASI_Hs01_00286414 predicted 793
9 SASI_Hs01_00286415 predicted 1045
10 SASI_Hs01_00286416 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520165 predicted 2278
2 SASI_Hs02_00520166 predicted 1855
3 SASI_Hs02_00520167 predicted 2669
4 SASI_Hs02_00520168 predicted 3121
5 SASI_Hs02_00520169 predicted 974
6 SASI_Hs02_00520170 predicted 3095
7 SASI_Hs02_00520171 predicted 2757
8 SASI_Hs02_00520172 predicted 1794
9 SASI_Hs02_00520173 predicted 743
10 SASI_Hs02_00520174 predicted 1488
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520175 predicted 2208
2 SASI_Hs02_00520176 predicted 1787
3 SASI_Hs02_00520177 predicted 2601
4 SASI_Hs02_00520178 predicted 3055
5 SASI_Hs02_00520179 predicted 911
6 SASI_Hs02_00520180 predicted 3025
7 SASI_Hs02_00520181 predicted 2689
8 SASI_Hs02_00520182 predicted 1723
9 SASI_Hs02_00520183 predicted 675
10 SASI_Hs02_00520184 predicted 1421
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055050 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278232 predicted 452
2 SASI_Rn02_00278233 predicted 290
3 SASI_Rn02_00278234 predicted 375
4 SASI_Rn02_00278235 predicted 293
5 SASI_Rn02_00278236 predicted 438
6 SASI_Rn02_00278237 predicted 360
7 SASI_Rn02_00278238 predicted 282
8 SASI_Rn02_00278239 predicted 473
9 SASI_Rn02_00278240 predicted 326
10 SASI_Rn02_00278241 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424206 predicted 705
2 SASI_Mm01_00271692 predicted 1528
3 SASI_Mm01_00271696 predicted 1821
4 SASI_Mm02_00424207 predicted 1706
5 SASI_Mm02_00424208 predicted 1765
6 SASI_Mm02_00424209 predicted 2041
7 SASI_Mm02_00424210 predicted 1875
8 SASI_Mm02_00424211 predicted 981
9 SASI_Mm02_00424212 predicted 1719
10 SASI_Mm02_00424213 predicted 1975
11 SASI_Mm01_00271688 predicted 1028
12 SASI_Mm01_00271689 predicted 860
13 SASI_Mm01_00271690 predicted 987
14 SASI_Mm01_00271691 predicted 1059
15 SASI_Mm01_00271693 predicted 1060
16 SASI_Mm01_00271694 predicted 859
17 SASI_Mm01_00271695 predicted 1373
18 SASI_Mm01_00271697 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432892 predicted 711
2 SASI_Mm02_00432893 predicted 1547
3 SASI_Mm02_00432894 predicted 1844
4 SASI_Mm02_00432895 predicted 1729
5 SASI_Mm02_00432896 predicted 1779
6 SASI_Mm02_00432897 predicted 2066
7 SASI_Mm02_00432898 predicted 2083
8 SASI_Mm02_00432899 predicted 1904
9 SASI_Mm02_00432900 predicted 1737
10 SASI_Mm02_00432901 predicted 1999
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127466
UBE2QL1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2Q family-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127466.6-997s1c1
Sequence:CCGGCGACATAACTTGAAGATGTATCTCGAGATACATCTTCAAGTTATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127466.6-92s1c1
Sequence:CCGGCCGCTTCATCTCGGTGGAGCTCTCGAGAGCTCCACCGAGATGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127466.6-366s1c1
Sequence:CCGGGAGGCCGTCATGCGCCAGTTTCTCGAGAAACTGGCGCATGACGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127466.6-454s1c1
Sequence:CCGGGCCGCAAGGAAGCTGAAGCAACTCGAGTTGCTTCAGCTTCCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127466.6-467s1c1
Sequence:CCGGTGAAGCAACCTTTAAGAGTTTCTCGAGAAACTCTTAAAGGTTGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127466
UBE2QL1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2Q family-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127466.6-997s1c1
Sequence:CCGGCGACATAACTTGAAGATGTATCTCGAGATACATCTTCAAGTTATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127466.6-92s1c1
Sequence:CCGGCCGCTTCATCTCGGTGGAGCTCTCGAGAGCTCCACCGAGATGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127466.6-366s1c1
Sequence:CCGGGAGGCCGTCATGCGCCAGTTTCTCGAGAAACTGGCGCATGACGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127466.6-454s1c1
Sequence:CCGGGCCGCAAGGAAGCTGAAGCAACTCGAGTTGCTTCAGCTTCCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127466.6-467s1c1
Sequence:CCGGTGAAGCAACCTTTAAGAGTTTCTCGAGAAACTCTTAAAGGTTGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127466
UBE2QL1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2Q family-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127466.6-997s1c1
Sequence:CCGGCGACATAACTTGAAGATGTATCTCGAGATACATCTTCAAGTTATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127466.6-92s1c1
Sequence:CCGGCCGCTTCATCTCGGTGGAGCTCTCGAGAGCTCCACCGAGATGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127466.6-366s1c1
Sequence:CCGGGAGGCCGTCATGCGCCAGTTTCTCGAGAAACTGGCGCATGACGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127466.6-454s1c1
Sequence:CCGGGCCGCAAGGAAGCTGAAGCAACTCGAGTTGCTTCAGCTTCCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127466.6-467s1c1
Sequence:CCGGTGAAGCAACCTTTAAGAGTTTCTCGAGAAACTCTTAAAGGTTGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145161
UBE2QL1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2Q family-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145161.1-675s21c1
Sequence:CCGGAGGAAGCTGAAGCTACCTTTACTCGAGTAAAGGTAGCTTCAGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145161.1-340s21c1
Sequence:CCGGCCTGTTCGACTGGAACGTGAACTCGAGTTCACGTTCCAGTCGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145161.1-945s21c1
Sequence:CCGGTTCGGATTATGTTTCGATTATCTCGAGATAATCGAAACATAATCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145161.1-699s21c1
Sequence:CCGGGTTTGGTGAAGACGCATGAAACTCGAGTTTCATGCGTCTTCACCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145161.1-406s21c1
Sequence:CCGGGGAGACCAACACCGAGTTCATCTCGAGATGAACTCGGTGTTGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145161
UBE2QL1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2Q family-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145161.1-675s21c1
Sequence:CCGGAGGAAGCTGAAGCTACCTTTACTCGAGTAAAGGTAGCTTCAGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145161.1-340s21c1
Sequence:CCGGCCTGTTCGACTGGAACGTGAACTCGAGTTCACGTTCCAGTCGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145161.1-945s21c1
Sequence:CCGGTTCGGATTATGTTTCGATTATCTCGAGATAATCGAAACATAATCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145161.1-699s21c1
Sequence:CCGGGTTTGGTGAAGACGCATGAAACTCGAGTTTCATGCGTCTTCACCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145161.1-406s21c1
Sequence:CCGGGGAGACCAACACCGAGTTCATCTCGAGATGAACTCGGTGTTGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145161
UBE2QL1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2Q family-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145161.1-675s21c1
Sequence:CCGGAGGAAGCTGAAGCTACCTTTACTCGAGTAAAGGTAGCTTCAGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145161.1-340s21c1
Sequence:CCGGCCTGTTCGACTGGAACGTGAACTCGAGTTCACGTTCCAGTCGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145161.1-945s21c1
Sequence:CCGGTTCGGATTATGTTTCGATTATCTCGAGATAATCGAAACATAATCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145161.1-699s21c1
Sequence:CCGGGTTTGGTGAAGACGCATGAAACTCGAGTTTCATGCGTCTTCACCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145161.1-406s21c1
Sequence:CCGGGGAGACCAACACCGAGTTCATCTCGAGATGAACTCGGTGTTGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks