EMAIL THIS PAGE TO A FRIEND

UBE2R2

ubiquitin-conjugating enzyme E2R 2

Synonyms: CDC34B E2-CDC34B UBC3B
UniProtKB ID: Q712K3, D3DRL5, Q9NX64
Gene ID:
Human(54926) Summary: Protein kinase CK2 is a ubiquitous and pleiotropic Ser/Thr protein kinase involved in cell growth and transformation. This gene encodes a protein similar to the E2 ubiquitin conjugating enzyme UBC3/CDC34. Studies suggest that CK2-dependent phosphorylation of this ubiquitin-conjugating enzyme functions by regulating beta-TrCP substrate recognition and induces its interaction with beta-TrCP, enhancing beta-catenin degradation. [provided by RefSeq, Jul 2008]
Mouse(67615) ubiquitin-conjugating enzyme E2R 2
Rat(299677) ubiquitin-conjugating enzyme E2R 2
cow(537885) ubiquitin-conjugating enzyme E2R 2
sheep(101103036) ubiquitin-conjugating enzyme E2R 2
naked mole-rat(101726324) ubiquitin-conjugating enzyme E2R 2
domestic guinea pig(100720432) ubiquitin-conjugating enzyme E2R 2
Zebrafish(436873) ubiquitin-conjugating enzyme E2R 2
chicken(427021) ubiquitin-conjugating enzyme E2R 2
dog(611799) ubiquitin-conjugating enzyme E2R 2
domestic cat(101090148) ubiquitin-conjugating enzyme E2R 2
133 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017811 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017811 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017811 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026275 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026275 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026275 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017811 Rosetta Predictions human pricing
XM_216864 Rosetta Predictions rat pricing
NM_026275 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058641 predicted 1467
2 SASI_Hs01_00058647 predicted 786
3 SASI_Hs01_00058642 predicted 1484
4 SASI_Hs01_00058644 predicted 735
5 SASI_Hs01_00058645 predicted 740
6 SASI_Hs01_00058646 predicted 1069
7 SASI_Hs01_00058648 predicted 995
8 SASI_Hs01_00058649 predicted 750
9 SASI_Hs01_00058650 predicted 1081
10 SASI_Hs02_00350675 predicted 585
11 SASI_Hs01_00058643 predicted 1487
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216864 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184876 predicted 14
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198164 predicted 401
2 SASI_Mm01_00198165 predicted 237
3 SASI_Mm01_00198167 predicted 219
4 SASI_Mm01_00198168 predicted 211
5 SASI_Mm01_00198169 predicted 656
6 SASI_Mm02_00329968 predicted 375
7 SASI_Mm01_00198170 predicted 316
8 SASI_Mm01_00198171 predicted 526
9 SASI_Mm01_00198172 predicted 826
10 SASI_Mm01_00198173 predicted 409
11 SASI_Mm01_00198166 predicted 405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017811
VALIDATED
UBE2R2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2R 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017811.3-930s21c1
Sequence:CCGGATGTGAGGACTATCCTATTAACTCGAGTTAATAGGATAGTCCTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017811.3-741s21c1
Sequence:CCGGGCTACTTCAAGGCGCATATTACTCGAGTAATATGCGCCTTGAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017811.3-785s21c1
Sequence:CCGGTCACCACCTACCTTCAGATTCCTCGAGGAATCTGAAGGTAGGTGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017811.x-750s1c1
Sequence:CCGGCTGGCGGAATACTGCATCAAACTCGAGTTTGATGCAGTATTCCGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017811.x-610s1c1
Sequence:CCGGCCAATGTCGATGCTTCAGTTACTCGAGTAACTGAAGCATCGACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017811.x-1518s1c1
Sequence:CCGGGCCTGATGAAATGTGCTCCTTCTCGAGAAGGAGCACATTTCATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017811.x-864s1c1
Sequence:CCGGGCCGACTGTTATGATGATGATCTCGAGATCATCATCATAACAGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017811.x-812s1c1
Sequence:CCGGCGACGACTTGTATGATGACGACTCGAGTCGTCATCATACAAGTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017811
VALIDATED
UBE2R2 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2R 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017811.3-930s21c1
Sequence:CCGGATGTGAGGACTATCCTATTAACTCGAGTTAATAGGATAGTCCTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017811.3-741s21c1
Sequence:CCGGGCTACTTCAAGGCGCATATTACTCGAGTAATATGCGCCTTGAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017811.3-785s21c1
Sequence:CCGGTCACCACCTACCTTCAGATTCCTCGAGGAATCTGAAGGTAGGTGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017811.x-750s1c1
Sequence:CCGGCTGGCGGAATACTGCATCAAACTCGAGTTTGATGCAGTATTCCGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017811.x-610s1c1
Sequence:CCGGCCAATGTCGATGCTTCAGTTACTCGAGTAACTGAAGCATCGACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017811.x-1518s1c1
Sequence:CCGGGCCTGATGAAATGTGCTCCTTCTCGAGAAGGAGCACATTTCATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017811.x-864s1c1
Sequence:CCGGGCCGACTGTTATGATGATGATCTCGAGATCATCATCATAACAGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017811.x-812s1c1
Sequence:CCGGCGACGACTTGTATGATGACGACTCGAGTCGTCATCATACAAGTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017811
VALIDATED
UBE2R2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2R 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017811.3-930s21c1
Sequence:CCGGATGTGAGGACTATCCTATTAACTCGAGTTAATAGGATAGTCCTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017811.3-741s21c1
Sequence:CCGGGCTACTTCAAGGCGCATATTACTCGAGTAATATGCGCCTTGAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017811.3-785s21c1
Sequence:CCGGTCACCACCTACCTTCAGATTCCTCGAGGAATCTGAAGGTAGGTGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017811.x-750s1c1
Sequence:CCGGCTGGCGGAATACTGCATCAAACTCGAGTTTGATGCAGTATTCCGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017811.x-610s1c1
Sequence:CCGGCCAATGTCGATGCTTCAGTTACTCGAGTAACTGAAGCATCGACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017811.x-1518s1c1
Sequence:CCGGGCCTGATGAAATGTGCTCCTTCTCGAGAAGGAGCACATTTCATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017811.x-864s1c1
Sequence:CCGGGCCGACTGTTATGATGATGATCTCGAGATCATCATCATAACAGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017811.x-812s1c1
Sequence:CCGGCGACGACTTGTATGATGACGACTCGAGTCGTCATCATACAAGTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026275
VALIDATED
UBE2R2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2R 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026275.4-240s21c1
Sequence:CCGGTTCCTATTGATTACCCATATTCTCGAGAATATGGGTAATCAATAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026275.4-214s21c1
Sequence:CCGGCGGCTACTTCAAGGCACATATCTCGAGATATGTGCCTTGAAGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026275.4-269s21c1
Sequence:CCGGACCTTCAGATTCTTGACCAAACTCGAGTTTGGTCAAGAATCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026275.4-479s21c1
Sequence:CCGGGCTTCAGTCATGTTCAGGAAACTCGAGTTTCCTGAACATGACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026275.2-608s1c1
Sequence:CCGGCCTGGCAGAATACTGCATCAACTCGAGTTGATGCAGTATTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026275.2-85s1c1
Sequence:CCGGCCCTGATGCTTGAGCTGAAATCTCGAGATTTCAGCTCAAGCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026275.2-270s1c1
Sequence:CCGGACCTTCAGATTCTTGACCAAACTCGAGTTTGGTCAAGAATCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026275.2-215s1c1
Sequence:CCGGCGGCTACTTCAAGGCACATATCTCGAGATATGTGCCTTGAAGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026275.2-480s1c1
Sequence:CCGGGCTTCAGTCATGTTCAGGAAACTCGAGTTTCCTGAACATGACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026275
VALIDATED
UBE2R2 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2R 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026275.4-240s21c1
Sequence:CCGGTTCCTATTGATTACCCATATTCTCGAGAATATGGGTAATCAATAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026275.4-214s21c1
Sequence:CCGGCGGCTACTTCAAGGCACATATCTCGAGATATGTGCCTTGAAGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026275.4-269s21c1
Sequence:CCGGACCTTCAGATTCTTGACCAAACTCGAGTTTGGTCAAGAATCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026275.4-479s21c1
Sequence:CCGGGCTTCAGTCATGTTCAGGAAACTCGAGTTTCCTGAACATGACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026275.2-608s1c1
Sequence:CCGGCCTGGCAGAATACTGCATCAACTCGAGTTGATGCAGTATTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026275.2-85s1c1
Sequence:CCGGCCCTGATGCTTGAGCTGAAATCTCGAGATTTCAGCTCAAGCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026275.2-270s1c1
Sequence:CCGGACCTTCAGATTCTTGACCAAACTCGAGTTTGGTCAAGAATCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026275.2-215s1c1
Sequence:CCGGCGGCTACTTCAAGGCACATATCTCGAGATATGTGCCTTGAAGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026275.2-480s1c1
Sequence:CCGGGCTTCAGTCATGTTCAGGAAACTCGAGTTTCCTGAACATGACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026275
VALIDATED
UBE2R2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2R 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026275.4-240s21c1
Sequence:CCGGTTCCTATTGATTACCCATATTCTCGAGAATATGGGTAATCAATAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026275.4-214s21c1
Sequence:CCGGCGGCTACTTCAAGGCACATATCTCGAGATATGTGCCTTGAAGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026275.4-269s21c1
Sequence:CCGGACCTTCAGATTCTTGACCAAACTCGAGTTTGGTCAAGAATCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026275.4-479s21c1
Sequence:CCGGGCTTCAGTCATGTTCAGGAAACTCGAGTTTCCTGAACATGACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026275.2-608s1c1
Sequence:CCGGCCTGGCAGAATACTGCATCAACTCGAGTTGATGCAGTATTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026275.2-85s1c1
Sequence:CCGGCCCTGATGCTTGAGCTGAAATCTCGAGATTTCAGCTCAAGCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026275.2-270s1c1
Sequence:CCGGACCTTCAGATTCTTGACCAAACTCGAGTTTGGTCAAGAATCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026275.2-215s1c1
Sequence:CCGGCGGCTACTTCAAGGCACATATCTCGAGATATGTGCCTTGAAGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026275.2-480s1c1
Sequence:CCGGGCTTCAGTCATGTTCAGGAAACTCGAGTTTCCTGAACATGACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks