EMAIL THIS PAGE TO A FRIEND

UBE2S

ubiquitin-conjugating enzyme E2S

Synonyms: E2-EPF E2EPF EPF5
UniProtKB ID: Q16763, Q9BTC1
Gene ID:
Human(27338) Summary: This gene encodes a member of the ubiquitin-conjugating enzyme family. The encoded protein is able to form a thiol ester linkage with ubiquitin in a ubiquitin activating enzyme-dependent manner, a characteristic property of ubiquitin carrier proteins. [provided by RefSeq, Jul 2008]
Mouse(77891) ubiquitin-conjugating enzyme E2S
Rat(292588) ubiquitin-conjugating enzyme E2S
dog(403671) ubiquitin-conjugating enzyme E2S
domestic cat(101090565) ubiquitin-conjugating enzyme E2S
domestic guinea pig(100734699) ubiquitin-conjugating enzyme E2S
naked mole-rat(101704537) ubiquitin-conjugating enzyme E2S
cow(617703) ubiquitin-conjugating enzyme E2S
sheep(101120352) ubiquitin-conjugating enzyme E2S
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014501 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014501 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014501 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133777 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133777 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133777 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014501 Rosetta Predictions human pricing
NM_001106224 Rosetta Predictions rat pricing
NM_133777 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070712 predicted 810
2 SASI_Hs01_00070713 predicted 771
3 SASI_Hs01_00070714 predicted 762
4 SASI_Hs01_00070715 predicted 676
5 SASI_Hs01_00070716 predicted 800
6 SASI_Hs01_00070717 predicted 646
7 SASI_Hs01_00070718 predicted 589
8 SASI_Hs01_00070719 predicted 870
9 SASI_Hs01_00070720 predicted 965
10 SASI_Hs01_00070721 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106224 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216858 predicted 263
2 SASI_Rn02_00216859 predicted 459
3 SASI_Rn02_00216860 predicted 199
4 SASI_Rn02_00216861 predicted 198
5 SASI_Rn02_00216862 predicted 499
6 SASI_Rn02_00216863 predicted 436
7 SASI_Rn02_00216864 predicted 439
8 SASI_Rn02_00216865 predicted 200
9 SASI_Rn02_00216866 predicted 317
10 SASI_Rn02_00216867 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133777 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145696 predicted 480
2 SASI_Mm02_00338792 predicted 197
3 SASI_Mm01_00145697 predicted 539
4 SASI_Mm01_00145699 predicted 444
5 SASI_Mm01_00145700 predicted 330
6 SASI_Mm01_00145701 predicted 532
7 SASI_Mm01_00145702 predicted 245
8 SASI_Mm01_00145703 predicted 394
9 SASI_Mm01_00145704 predicted 295
10 SASI_Mm01_00145705 predicted 531
11 SASI_Mm01_00145698 predicted 277
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014501
VALIDATED
UBE2S MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2S
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014501.1-739s1c1
Sequence:CCGGGGGCTCTCTTCCTCCTTCCACCTCGAGGTGGAAGGAGGAAGAGAGCCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014501.1-141s1c1
Sequence:CCGGCCCGATGGCATCAAGGTCTTTCTCGAGAAAGACCTTGATGCCATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014501.1-218s1c1
Sequence:CCGGCCCATATGCTGGAGGTCTGTTCTCGAGAACAGACCTCCAGCATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014501.1-738s1c1
Sequence:CCGGTGGGCTCTCTTCCTCCTTCCACTCGAGTGGAAGGAGGAAGAGAGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014501.1-89s1c1
Sequence:CCGGGCACATCATCCGCCTGGTGTACTCGAGTACACCAGGCGGATGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-649s21c1
Sequence:CCGGTCTGCGTCAACGTGCTCAAGACTCGAGTCTTGAGCACGTTGACGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-699s21c1
Sequence:CCGGCACGTACTGCTGACCATCAAGCTCGAGCTTGATGGTCAGCAGTACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-714s21c1
Sequence:CCGGATCAAGTGCCTGCTGATCCACCTCGAGGTGGATCAGCAGGCACTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-776s21c1
Sequence:CCGGGCTCTTGGAGAACTACGAGGACTCGAGTCCTCGTAGTTCTCCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-417s21c1
Sequence:CCGGTACAAGGAGGTGACGACACTGCTCGAGCAGTGTCGTCACCTCCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-461s21c1
Sequence:CCGGCAAGGTCTTTCCCAACGAGGACTCGAGTCCTCGTTGGGAAAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-611s21c1
Sequence:CCGGCAAGATCTTCCACCCGAACGTCTCGAGACGTTCGGGTGGAAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-946s21c1
Sequence:CCGGGTCCCATGGCCAAGAAGCATGCTCGAGCATGCTTCTTGGCCATGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-638s21c1
Sequence:CCGGCAATGGCGAGATCTGCGTCAACTCGAGTTGACGCAGATCTCGCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014501
VALIDATED
UBE2S MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2S
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014501.1-739s1c1
Sequence:CCGGGGGCTCTCTTCCTCCTTCCACCTCGAGGTGGAAGGAGGAAGAGAGCCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014501.1-141s1c1
Sequence:CCGGCCCGATGGCATCAAGGTCTTTCTCGAGAAAGACCTTGATGCCATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014501.1-218s1c1
Sequence:CCGGCCCATATGCTGGAGGTCTGTTCTCGAGAACAGACCTCCAGCATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014501.1-738s1c1
Sequence:CCGGTGGGCTCTCTTCCTCCTTCCACTCGAGTGGAAGGAGGAAGAGAGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014501.1-89s1c1
Sequence:CCGGGCACATCATCCGCCTGGTGTACTCGAGTACACCAGGCGGATGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-649s21c1
Sequence:CCGGTCTGCGTCAACGTGCTCAAGACTCGAGTCTTGAGCACGTTGACGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-699s21c1
Sequence:CCGGCACGTACTGCTGACCATCAAGCTCGAGCTTGATGGTCAGCAGTACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-714s21c1
Sequence:CCGGATCAAGTGCCTGCTGATCCACCTCGAGGTGGATCAGCAGGCACTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-776s21c1
Sequence:CCGGGCTCTTGGAGAACTACGAGGACTCGAGTCCTCGTAGTTCTCCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-417s21c1
Sequence:CCGGTACAAGGAGGTGACGACACTGCTCGAGCAGTGTCGTCACCTCCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-461s21c1
Sequence:CCGGCAAGGTCTTTCCCAACGAGGACTCGAGTCCTCGTTGGGAAAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-611s21c1
Sequence:CCGGCAAGATCTTCCACCCGAACGTCTCGAGACGTTCGGGTGGAAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-946s21c1
Sequence:CCGGGTCCCATGGCCAAGAAGCATGCTCGAGCATGCTTCTTGGCCATGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-638s21c1
Sequence:CCGGCAATGGCGAGATCTGCGTCAACTCGAGTTGACGCAGATCTCGCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014501
VALIDATED
UBE2S MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2S
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014501.1-739s1c1
Sequence:CCGGGGGCTCTCTTCCTCCTTCCACCTCGAGGTGGAAGGAGGAAGAGAGCCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014501.1-141s1c1
Sequence:CCGGCCCGATGGCATCAAGGTCTTTCTCGAGAAAGACCTTGATGCCATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014501.1-218s1c1
Sequence:CCGGCCCATATGCTGGAGGTCTGTTCTCGAGAACAGACCTCCAGCATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014501.1-738s1c1
Sequence:CCGGTGGGCTCTCTTCCTCCTTCCACTCGAGTGGAAGGAGGAAGAGAGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014501.1-89s1c1
Sequence:CCGGGCACATCATCCGCCTGGTGTACTCGAGTACACCAGGCGGATGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-649s21c1
Sequence:CCGGTCTGCGTCAACGTGCTCAAGACTCGAGTCTTGAGCACGTTGACGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-699s21c1
Sequence:CCGGCACGTACTGCTGACCATCAAGCTCGAGCTTGATGGTCAGCAGTACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-714s21c1
Sequence:CCGGATCAAGTGCCTGCTGATCCACCTCGAGGTGGATCAGCAGGCACTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-776s21c1
Sequence:CCGGGCTCTTGGAGAACTACGAGGACTCGAGTCCTCGTAGTTCTCCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-417s21c1
Sequence:CCGGTACAAGGAGGTGACGACACTGCTCGAGCAGTGTCGTCACCTCCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-461s21c1
Sequence:CCGGCAAGGTCTTTCCCAACGAGGACTCGAGTCCTCGTTGGGAAAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-611s21c1
Sequence:CCGGCAAGATCTTCCACCCGAACGTCTCGAGACGTTCGGGTGGAAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-946s21c1
Sequence:CCGGGTCCCATGGCCAAGAAGCATGCTCGAGCATGCTTCTTGGCCATGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014501.2-638s21c1
Sequence:CCGGCAATGGCGAGATCTGCGTCAACTCGAGTTGACGCAGATCTCGCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133777
UBE2S MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2S
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-205s1c1
Sequence:CCGGCCACATCATCCGCCTAGTGTACTCGAGTACACTAGGCGGATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-787s1c1
Sequence:CCGGAGATAAGAAGCTGGCAGCCAACTCGAGTTGGCTGCCAGCTTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-218s1c1
Sequence:CCGGCTAGTGTACAAGGAGGTGACACTCGAGTGTCACCTCCTTGTACACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-343s1c1
Sequence:CCGGTGGAGGTCTGTTCCGTATGAACTCGAGTTCATACGGAACAGACCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-278s1c1
Sequence:CCGGCCCAATGAGGAGGATCTCACACTCGAGTGTGAGATCCTCCTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-826s1c1
Sequence:CCGGGCGAGCACTGAGGCGACTGTACTCGAGTACAGTCGCCTCAGTGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-251s1c1
Sequence:CCGGGACCCACCTGATGGCATTAAACTCGAGTTTAATGCCATCAGGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-620s1c1
Sequence:CCGGCGTCTGCTCACAGAAATCCATCTCGAGATGGATTTCTGTGAGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-400s1c1
Sequence:CCGGCAAGGGCTACTTCCTGACTAACTCGAGTTAGTCAGGAAGTAGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-350s1c1
Sequence:CCGGCTGTTCCGTATGAAGCTCCTACTCGAGTAGGAGCTTCATACGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133777
UBE2S MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2S
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-205s1c1
Sequence:CCGGCCACATCATCCGCCTAGTGTACTCGAGTACACTAGGCGGATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-787s1c1
Sequence:CCGGAGATAAGAAGCTGGCAGCCAACTCGAGTTGGCTGCCAGCTTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-218s1c1
Sequence:CCGGCTAGTGTACAAGGAGGTGACACTCGAGTGTCACCTCCTTGTACACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-343s1c1
Sequence:CCGGTGGAGGTCTGTTCCGTATGAACTCGAGTTCATACGGAACAGACCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-278s1c1
Sequence:CCGGCCCAATGAGGAGGATCTCACACTCGAGTGTGAGATCCTCCTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-826s1c1
Sequence:CCGGGCGAGCACTGAGGCGACTGTACTCGAGTACAGTCGCCTCAGTGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-251s1c1
Sequence:CCGGGACCCACCTGATGGCATTAAACTCGAGTTTAATGCCATCAGGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-620s1c1
Sequence:CCGGCGTCTGCTCACAGAAATCCATCTCGAGATGGATTTCTGTGAGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-400s1c1
Sequence:CCGGCAAGGGCTACTTCCTGACTAACTCGAGTTAGTCAGGAAGTAGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-350s1c1
Sequence:CCGGCTGTTCCGTATGAAGCTCCTACTCGAGTAGGAGCTTCATACGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133777
UBE2S MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2S
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-205s1c1
Sequence:CCGGCCACATCATCCGCCTAGTGTACTCGAGTACACTAGGCGGATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-787s1c1
Sequence:CCGGAGATAAGAAGCTGGCAGCCAACTCGAGTTGGCTGCCAGCTTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-218s1c1
Sequence:CCGGCTAGTGTACAAGGAGGTGACACTCGAGTGTCACCTCCTTGTACACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-343s1c1
Sequence:CCGGTGGAGGTCTGTTCCGTATGAACTCGAGTTCATACGGAACAGACCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-278s1c1
Sequence:CCGGCCCAATGAGGAGGATCTCACACTCGAGTGTGAGATCCTCCTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-826s1c1
Sequence:CCGGGCGAGCACTGAGGCGACTGTACTCGAGTACAGTCGCCTCAGTGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-251s1c1
Sequence:CCGGGACCCACCTGATGGCATTAAACTCGAGTTTAATGCCATCAGGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-620s1c1
Sequence:CCGGCGTCTGCTCACAGAAATCCATCTCGAGATGGATTTCTGTGAGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-400s1c1
Sequence:CCGGCAAGGGCTACTTCCTGACTAACTCGAGTTAGTCAGGAAGTAGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133777.1-350s1c1
Sequence:CCGGCTGTTCCGTATGAAGCTCCTACTCGAGTAGGAGCTTCATACGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks