EMAIL THIS PAGE TO A FRIEND

UBE2T

ubiquitin-conjugating enzyme E2T (putative)

Synonyms: PIG50
UniProtKB ID: Q9NPD8, Q2TU36
Gene ID:
Human(29089) Summary: The covalent conjugation of ubiquitin to proteins regulates diverse cellular pathways and proteins. Ubiquitin is transferred to a target protein through a concerted action of a ubiquitin-activating enzyme (E1), a ubiquitin-conjugating enzyme (E2), such as UBE2T, and a ubiquitin ligase (E3) (Machida et al., 2006 [PubMed 16916645]
Mouse(67196) ubiquitin-conjugating enzyme E2T (putative)
Rat(360847) ubiquitin-conjugating enzyme E2T (putative)
Zebrafish(768152) ubiquitin-conjugating enzyme E2T (putative)
chicken(421149) ubiquitin-conjugating enzyme E2T (putative)
domestic cat(101098513) ubiquitin-conjugating enzyme E2T (putative)
dog(607154) ubiquitin-conjugating enzyme E2T (putative)
cow(505314) ubiquitin-conjugating enzyme E2T (putative)
sheep(101104415) ubiquitin-conjugating enzyme E2T (putative)
naked mole-rat(101714812) ubiquitin-conjugating enzyme E2T (putative)
domestic guinea pig(100730758) ubiquitin-conjugating enzyme E2T (putative)
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014176 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014176 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014176 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026024 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026024 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026024 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013731 MISSION® esiRNA esiRNA targeting human UBE2T (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014176 Rosetta Predictions human pricing
NM_001108344 Rosetta Predictions rat pricing
NM_026024 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129086 predicted 244
2 SASI_Hs01_00129087 predicted 454
3 SASI_Hs01_00129088 predicted 243
4 SASI_Hs01_00129089 predicted 493
5 SASI_Hs01_00129090 predicted 322
6 SASI_Hs01_00129091 predicted 317
7 SASI_Hs01_00129092 predicted 213
8 SASI_Hs01_00129093 predicted 214
9 SASI_Hs01_00129094 predicted 373
10 SASI_Hs01_00129095 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237739 predicted 591
2 SASI_Rn02_00237740 predicted 525
3 SASI_Rn02_00237741 predicted 600
4 SASI_Rn02_00237742 predicted 529
5 SASI_Rn02_00237743 predicted 755
6 SASI_Rn02_00237744 predicted 630
7 SASI_Rn02_00237745 predicted 641
8 SASI_Rn02_00237746 predicted 538
9 SASI_Rn02_00237747 predicted 744
10 SASI_Rn02_00237748 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026024 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071018 predicted 390
2 SASI_Mm01_00071019 predicted 581
3 SASI_Mm01_00071020 predicted 640
4 SASI_Mm01_00071021 predicted 476
5 SASI_Mm01_00071022 predicted 624
6 SASI_Mm01_00071023 predicted 515
7 SASI_Mm01_00071024 predicted 757
8 SASI_Mm01_00071025 predicted 567
9 SASI_Mm01_00071026 predicted 849
10 SASI_Mm01_00071027 predicted 418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014176
VALIDATED
UBE2T MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2T (putative)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014176.3-610s21c1
Sequence:CCGGTGAGGAAGAGATGCTTGATAACTCGAGTTATCAAGCATCTCTTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014176.3-709s21c1
Sequence:CCGGGAAATTTCATCCTGATGTTTACTCGAGTAAACATCAGGATGAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014176.3-358s21c1
Sequence:CCGGTTATCATCCAAACATTGATTCCTCGAGGAATCAATGTTTGGATGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014176.3-390s21c1
Sequence:CCGGTTTGTCTGGATGTTCTCAAATCTCGAGATTTGAGAACATCCAGACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014176.x-316s1c1
Sequence:CCGGGAACCTCCTCAGATCCGATTTCTCGAGAAATCGGATCTGAGGAGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014176.x-201s1c1
Sequence:CCGGGCAAGATAAAGACCAAATGGACTCGAGTCCATTTGGTCTTTATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014176.x-646s1c1
Sequence:CCGGGTACACAACTCAACACAGAAACTCGAGTTTCTGTGTTGAGTTGTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014176.x-250s1c1
Sequence:CCGGGCCAACACACCTTATGAGAAACTCGAGTTTCTCATAAGGTGTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014176.x-728s1c1
Sequence:CCGGGTCCTGGTTCATCTTAGTTAACTCGAGTTAACTAAGATGAACCAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014176
VALIDATED
UBE2T MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2T (putative)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014176.3-610s21c1
Sequence:CCGGTGAGGAAGAGATGCTTGATAACTCGAGTTATCAAGCATCTCTTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014176.3-709s21c1
Sequence:CCGGGAAATTTCATCCTGATGTTTACTCGAGTAAACATCAGGATGAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014176.3-358s21c1
Sequence:CCGGTTATCATCCAAACATTGATTCCTCGAGGAATCAATGTTTGGATGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014176.3-390s21c1
Sequence:CCGGTTTGTCTGGATGTTCTCAAATCTCGAGATTTGAGAACATCCAGACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014176.x-316s1c1
Sequence:CCGGGAACCTCCTCAGATCCGATTTCTCGAGAAATCGGATCTGAGGAGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014176.x-201s1c1
Sequence:CCGGGCAAGATAAAGACCAAATGGACTCGAGTCCATTTGGTCTTTATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014176.x-646s1c1
Sequence:CCGGGTACACAACTCAACACAGAAACTCGAGTTTCTGTGTTGAGTTGTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014176.x-250s1c1
Sequence:CCGGGCCAACACACCTTATGAGAAACTCGAGTTTCTCATAAGGTGTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014176.x-728s1c1
Sequence:CCGGGTCCTGGTTCATCTTAGTTAACTCGAGTTAACTAAGATGAACCAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014176
VALIDATED
UBE2T MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2T (putative)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014176.3-610s21c1
Sequence:CCGGTGAGGAAGAGATGCTTGATAACTCGAGTTATCAAGCATCTCTTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014176.3-709s21c1
Sequence:CCGGGAAATTTCATCCTGATGTTTACTCGAGTAAACATCAGGATGAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014176.3-358s21c1
Sequence:CCGGTTATCATCCAAACATTGATTCCTCGAGGAATCAATGTTTGGATGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014176.3-390s21c1
Sequence:CCGGTTTGTCTGGATGTTCTCAAATCTCGAGATTTGAGAACATCCAGACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014176.x-316s1c1
Sequence:CCGGGAACCTCCTCAGATCCGATTTCTCGAGAAATCGGATCTGAGGAGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014176.x-201s1c1
Sequence:CCGGGCAAGATAAAGACCAAATGGACTCGAGTCCATTTGGTCTTTATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014176.x-646s1c1
Sequence:CCGGGTACACAACTCAACACAGAAACTCGAGTTTCTGTGTTGAGTTGTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014176.x-250s1c1
Sequence:CCGGGCCAACACACCTTATGAGAAACTCGAGTTTCTCATAAGGTGTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014176.x-728s1c1
Sequence:CCGGGTCCTGGTTCATCTTAGTTAACTCGAGTTAACTAAGATGAACCAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026024
VALIDATED
UBE2T MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2T (putative)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026024.2-586s21c1
Sequence:CCGGGCCACTGTATTGACCTCTATTCTCGAGAATAGAGGTCAATACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026024.2-477s21c1
Sequence:CCGGCCGATTTCTAACTCCAATCTACTCGAGTAGATTGGAGTTAGAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026024.2-574s21c1
Sequence:CCGGTCCCTCAACATTGCCACTGTACTCGAGTACAGTGGCAATGTTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026024.2-899s21c1
Sequence:CCGGCTGTGTCAAGGTGGTCTCTTTCTCGAGAAAGAGACCACCTTGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026024.1-900s1c1
Sequence:CCGGCTGTGTCAAGGTGGTCTCTTTCTCGAGAAAGAGACCACCTTGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026024.1-587s1c1
Sequence:CCGGGCCACTGTATTGACCTCTATTCTCGAGAATAGAGGTCAATACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026024.1-478s1c1
Sequence:CCGGCCGATTTCTAACTCCAATCTACTCGAGTAGATTGGAGTTAGAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026024.1-575s1c1
Sequence:CCGGTCCCTCAACATTGCCACTGTACTCGAGTACAGTGGCAATGTTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026024.1-854s1c1
Sequence:CCGGCCTGACGTTCAGAGAGTCTATCTCGAGATAGACTCTCTGAACGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026024
VALIDATED
UBE2T MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2T (putative)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026024.2-586s21c1
Sequence:CCGGGCCACTGTATTGACCTCTATTCTCGAGAATAGAGGTCAATACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026024.2-477s21c1
Sequence:CCGGCCGATTTCTAACTCCAATCTACTCGAGTAGATTGGAGTTAGAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026024.2-574s21c1
Sequence:CCGGTCCCTCAACATTGCCACTGTACTCGAGTACAGTGGCAATGTTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026024.2-899s21c1
Sequence:CCGGCTGTGTCAAGGTGGTCTCTTTCTCGAGAAAGAGACCACCTTGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026024.1-900s1c1
Sequence:CCGGCTGTGTCAAGGTGGTCTCTTTCTCGAGAAAGAGACCACCTTGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026024.1-587s1c1
Sequence:CCGGGCCACTGTATTGACCTCTATTCTCGAGAATAGAGGTCAATACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026024.1-478s1c1
Sequence:CCGGCCGATTTCTAACTCCAATCTACTCGAGTAGATTGGAGTTAGAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026024.1-575s1c1
Sequence:CCGGTCCCTCAACATTGCCACTGTACTCGAGTACAGTGGCAATGTTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026024.1-854s1c1
Sequence:CCGGCCTGACGTTCAGAGAGTCTATCTCGAGATAGACTCTCTGAACGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026024
VALIDATED
UBE2T MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2T (putative)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026024.2-586s21c1
Sequence:CCGGGCCACTGTATTGACCTCTATTCTCGAGAATAGAGGTCAATACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026024.2-477s21c1
Sequence:CCGGCCGATTTCTAACTCCAATCTACTCGAGTAGATTGGAGTTAGAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026024.2-574s21c1
Sequence:CCGGTCCCTCAACATTGCCACTGTACTCGAGTACAGTGGCAATGTTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026024.2-899s21c1
Sequence:CCGGCTGTGTCAAGGTGGTCTCTTTCTCGAGAAAGAGACCACCTTGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026024.1-900s1c1
Sequence:CCGGCTGTGTCAAGGTGGTCTCTTTCTCGAGAAAGAGACCACCTTGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026024.1-587s1c1
Sequence:CCGGGCCACTGTATTGACCTCTATTCTCGAGAATAGAGGTCAATACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026024.1-478s1c1
Sequence:CCGGCCGATTTCTAACTCCAATCTACTCGAGTAGATTGGAGTTAGAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026024.1-575s1c1
Sequence:CCGGTCCCTCAACATTGCCACTGTACTCGAGTACAGTGGCAATGTTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026024.1-854s1c1
Sequence:CCGGCCTGACGTTCAGAGAGTCTATCTCGAGATAGACTCTCTGAACGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks