EMAIL THIS PAGE TO A FRIEND

UBE2U

ubiquitin-conjugating enzyme E2U (putative)

Synonyms: RP4-636O23.1
UniProtKB ID: Q5VVX9, Q8N1D4
Gene ID:
Mouse(381534) ubiquitin-conjugating enzyme E2U (putative)
Rat(500511) ubiquitin-conjugating enzyme E2U (putative)
domestic guinea pig(100727733) ubiquitin-conjugating enzyme E2U (putative)
cow(784986) ubiquitin-conjugating enzyme E2U (putative)
sheep(101109925) ubiquitin-conjugating enzyme E2U (putative)
domestic cat(101084124) ubiquitin-conjugating enzyme E2U (putative)
dog(609932) ubiquitin-conjugating enzyme E2U (putative)
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152489 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152489 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152489 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033773 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033773 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033773 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152489 Rosetta Predictions human pricing
XM_575874 Rosetta Predictions rat pricing
XR_007925 Rosetta Predictions rat pricing
NM_001033773 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182543 predicted 317
2 SASI_Hs01_00182544 predicted 624
3 SASI_Hs02_00366264 predicted 626
4 SASI_Hs01_00182545 predicted 582
5 SASI_Hs01_00182546 predicted 660
6 SASI_Hs02_00366265 predicted 607
7 SASI_Hs01_00182547 predicted 560
8 SASI_Hs01_00182548 predicted 465
9 SASI_Hs01_00182550 predicted 304
10 SASI_Hs01_00182552 predicted 373
11 SASI_Hs01_00182549 predicted 590
12 SASI_Hs01_00182551 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575874 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00196595 predicted 341
2 SASI_Rn01_00196596 predicted 376
3 SASI_Rn01_00196597 predicted 409
4 SASI_Rn01_00196598 predicted 375
5 SASI_Rn01_00196599 predicted 337
6 SASI_Rn01_00196600 predicted 346
7 SASI_Rn01_00196601 predicted 334
8 SASI_Rn01_00196602 predicted 361
9 SASI_Rn01_00196603 predicted 342
10 SASI_Rn01_00196604 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007925 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00177186 predicted 1317
2 SASI_Rn02_00415829 predicted 1307
3 SASI_Rn01_00177187 predicted 1207
4 SASI_Rn01_00177188 predicted 1299
5 SASI_Rn01_00177190 predicted 1284
6 SASI_Rn01_00177191 predicted 1445
7 SASI_Rn01_00177192 predicted 1310
8 SASI_Rn01_00177193 predicted 1381
9 SASI_Rn01_00177194 predicted 1233
10 SASI_Rn01_00177195 predicted 1269
11 SASI_Rn01_00177189 predicted 1313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033773 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065494 predicted 613
2 SASI_Mm01_00065495 predicted 776
3 SASI_Mm01_00065496 predicted 620
4 SASI_Mm01_00065498 predicted 724
5 SASI_Mm01_00065499 predicted 634
6 SASI_Mm01_00065500 predicted 785
7 SASI_Mm01_00065501 predicted 620
8 SASI_Mm01_00065502 predicted 631
9 SASI_Mm01_00065503 predicted 610
10 SASI_Mm02_00288973 predicted 717
11 SASI_Mm01_00065497 predicted 581
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152489
UBE2U MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2U (putative)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152489.1-990s1c1
Sequence:CCGGGAAATTCTTAACCACTCTGAACTCGAGTTCAGAGTGGTTAAGAATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152489.1-577s1c1
Sequence:CCGGCCTACAGGTTATGCTTTCTAACTCGAGTTAGAAAGCATAACCTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152489.1-443s1c1
Sequence:CCGGCCTCCAGTTGTGAAATTTATACTCGAGTATAAATTTCACAACTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152489.1-632s1c1
Sequence:CCGGGCCAGAATACTGGTTAAAGATCTCGAGATCTTTAACCAGTATTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152489.1-898s1c1
Sequence:CCGGGCATCAGAAAGAATGGAATTTCTCGAGAAATTCCATTCTTTCTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152489.1-724s21c1
Sequence:CCGGACCTAAAGACCCACGTAAATGCTCGAGCATTTACGTGGGTCTTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152489.1-534s21c1
Sequence:CCGGAGAAGTGGAATACAAACTATACTCGAGTATAGTTTGTATTCCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152489.1-836s21c1
Sequence:CCGGCCATTGCTCAAAGTTCCAAATCTCGAGATTTGGAACTTTGAGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152489.1-288s21c1
Sequence:CCGGATCTCAAGGAGAACAATTATACTCGAGTATAATTGTTCTCCTTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152489
UBE2U MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2U (putative)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152489.1-990s1c1
Sequence:CCGGGAAATTCTTAACCACTCTGAACTCGAGTTCAGAGTGGTTAAGAATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152489.1-577s1c1
Sequence:CCGGCCTACAGGTTATGCTTTCTAACTCGAGTTAGAAAGCATAACCTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152489.1-443s1c1
Sequence:CCGGCCTCCAGTTGTGAAATTTATACTCGAGTATAAATTTCACAACTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152489.1-632s1c1
Sequence:CCGGGCCAGAATACTGGTTAAAGATCTCGAGATCTTTAACCAGTATTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152489.1-898s1c1
Sequence:CCGGGCATCAGAAAGAATGGAATTTCTCGAGAAATTCCATTCTTTCTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152489.1-724s21c1
Sequence:CCGGACCTAAAGACCCACGTAAATGCTCGAGCATTTACGTGGGTCTTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152489.1-534s21c1
Sequence:CCGGAGAAGTGGAATACAAACTATACTCGAGTATAGTTTGTATTCCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152489.1-836s21c1
Sequence:CCGGCCATTGCTCAAAGTTCCAAATCTCGAGATTTGGAACTTTGAGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152489.1-288s21c1
Sequence:CCGGATCTCAAGGAGAACAATTATACTCGAGTATAATTGTTCTCCTTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152489
UBE2U MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2U (putative)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152489.1-990s1c1
Sequence:CCGGGAAATTCTTAACCACTCTGAACTCGAGTTCAGAGTGGTTAAGAATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152489.1-577s1c1
Sequence:CCGGCCTACAGGTTATGCTTTCTAACTCGAGTTAGAAAGCATAACCTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152489.1-443s1c1
Sequence:CCGGCCTCCAGTTGTGAAATTTATACTCGAGTATAAATTTCACAACTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152489.1-632s1c1
Sequence:CCGGGCCAGAATACTGGTTAAAGATCTCGAGATCTTTAACCAGTATTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152489.1-898s1c1
Sequence:CCGGGCATCAGAAAGAATGGAATTTCTCGAGAAATTCCATTCTTTCTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152489.1-724s21c1
Sequence:CCGGACCTAAAGACCCACGTAAATGCTCGAGCATTTACGTGGGTCTTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152489.1-534s21c1
Sequence:CCGGAGAAGTGGAATACAAACTATACTCGAGTATAGTTTGTATTCCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152489.1-836s21c1
Sequence:CCGGCCATTGCTCAAAGTTCCAAATCTCGAGATTTGGAACTTTGAGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152489.1-288s21c1
Sequence:CCGGATCTCAAGGAGAACAATTATACTCGAGTATAATTGTTCTCCTTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033773
UBE2U MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2U (putative)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033773.3-1247s21c1
Sequence:CCGGTGAGTACTTTGACAACGTAAACTCGAGTTTACGTTGTCAAAGTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033773.3-731s21c1
Sequence:CCGGGGATCGAGTCAGGGTAATTAACTCGAGTTAATTACCCTGACTCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033773.3-635s21c1
Sequence:CCGGTAGAAATGCGTCTACGTATAACTCGAGTTATACGTAGACGCATTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033773.3-898s21c1
Sequence:CCGGTGCAATGGGAGTCCAAGTTTGCTCGAGCAAACTTGGACTCCCATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033773.3-850s21c1
Sequence:CCGGTCATGGGACAGTATTACAAATCTCGAGATTTGTAATACTGTCCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033773
UBE2U MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2U (putative)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033773.3-1247s21c1
Sequence:CCGGTGAGTACTTTGACAACGTAAACTCGAGTTTACGTTGTCAAAGTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033773.3-731s21c1
Sequence:CCGGGGATCGAGTCAGGGTAATTAACTCGAGTTAATTACCCTGACTCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033773.3-635s21c1
Sequence:CCGGTAGAAATGCGTCTACGTATAACTCGAGTTATACGTAGACGCATTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033773.3-898s21c1
Sequence:CCGGTGCAATGGGAGTCCAAGTTTGCTCGAGCAAACTTGGACTCCCATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033773.3-850s21c1
Sequence:CCGGTCATGGGACAGTATTACAAATCTCGAGATTTGTAATACTGTCCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033773
UBE2U MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2U (putative)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033773.3-1247s21c1
Sequence:CCGGTGAGTACTTTGACAACGTAAACTCGAGTTTACGTTGTCAAAGTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033773.3-731s21c1
Sequence:CCGGGGATCGAGTCAGGGTAATTAACTCGAGTTAATTACCCTGACTCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033773.3-635s21c1
Sequence:CCGGTAGAAATGCGTCTACGTATAACTCGAGTTATACGTAGACGCATTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033773.3-898s21c1
Sequence:CCGGTGCAATGGGAGTCCAAGTTTGCTCGAGCAAACTTGGACTCCCATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033773.3-850s21c1
Sequence:CCGGTCATGGGACAGTATTACAAATCTCGAGATTTGTAATACTGTCCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks