EMAIL THIS PAGE TO A FRIEND

UBE2V1

ubiquitin-conjugating enzyme E2 variant 1

Synonyms: CIR1 CROC-1 CROC1 UBE2V UEV-1 UEV1 UEV1A
Gene ID:
Human(7335) Summary: Ubiquitin-conjugating E2 enzyme variant proteins constitute a distinct subfamily within the E2 protein family. They have sequence similarity to other ubiquitin-conjugating enzymes but lack the conserved cysteine residue that is critical for the catalytic activity of E2s. The protein encoded by this gene is located in the nucleus and can cause transcriptional activation of the human FOS proto-oncogene. It is thought to be involved in the control of differentiation by altering cell cycle behavior. Alternatively spliced transcript variants encoding multiple isoforms have been described for this gene, and multiple pseudogenes of this gene have been identified. Co-transcription of this gene and the neighboring upstream gene generates a rare transcript (Kua-UEV), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Apr 2012]
Mouse(66589) ubiquitin-conjugating enzyme E2 variant 1
Rat(296390) ubiquitin-conjugating enzyme E2 variant 1
Zebrafish(641324) ubiquitin-conjugating enzyme E2 variant 1
chicken(100538349) ubiquitin-conjugating enzyme E2 variant 1
dog(477262) ubiquitin-conjugating enzyme E2 variant 1
dog(100538347) ubiquitin-conjugating enzyme E2 variant 1
cow(617771) ubiquitin-conjugating enzyme E2 variant 1
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1300644 Anti-CROC1A (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB1300643 Anti-CROC1A (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
HPA059549 Anti-TMEM189 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1300640 Anti-UBE2V (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
ELISA, western blot pricing
SAB4301818 Anti-UBE2V1 affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB1300641 Anti-UBE2V1 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB1300270 Anti-UBE2V1 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1400291 Anti-UBE2V1 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1400292 Anti-UBE2V1 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
HPA052535 Anti-UBE2V1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
HPA053186 Anti-UBE2V1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB1300642 Anti-UEV (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA pricing
SAB2501084 Anti-UEV1/CROC1 (221 AA Isoform B) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
PRS3375 Anti-UEV1A antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021988 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021988 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021988 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023230 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023230 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023230 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032288 Rosetta Predictions human pricing
NM_021988 Rosetta Predictions human pricing
NM_022442 Rosetta Predictions human pricing
NM_199144 Rosetta Predictions human pricing
NM_001110345 Rosetta Predictions rat pricing
NM_023230 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020112 predicted 419
2 SASI_Hs01_00020119 predicted 748
3 SASI_Hs01_00020121 predicted 707
4 SASI_Hs01_00020113 predicted 734
5 SASI_Hs01_00020114 predicted 636
6 SASI_Hs01_00020115 predicted 740
7 SASI_Hs01_00020116 predicted 739
8 SASI_Hs01_00020117 predicted 625
9 SASI_Hs01_00020118 predicted 662
10 SASI_Hs01_00020120 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190357 predicted 818
2 SASI_Hs01_00190364 predicted 1159
3 SASI_Hs01_00190366 predicted 1121
4 SASI_Hs01_00190358 predicted 1136
5 SASI_Hs01_00190359 predicted 1040
6 SASI_Hs01_00190360 predicted 1146
7 SASI_Hs01_00190361 predicted 1143
8 SASI_Hs01_00190362 predicted 1034
9 SASI_Hs01_00190363 predicted 1062
10 SASI_Hs01_00190365 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243837 predicted 462
2 SASI_Hs01_00243844 predicted 798
3 SASI_Hs01_00243846 predicted 757
4 SASI_Hs01_00243838 predicted 776
5 SASI_Hs01_00243839 predicted 686
6 SASI_Hs01_00243840 predicted 782
7 SASI_Hs01_00243841 predicted 778
8 SASI_Hs01_00243842 predicted 668
9 SASI_Hs01_00243843 predicted 699
10 SASI_Hs01_00243845 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012584 predicted 742
2 SASI_Hs01_00012591 predicted 1082
3 SASI_Hs01_00012593 predicted 1043
4 SASI_Hs01_00012585 predicted 1058
5 SASI_Hs01_00012586 predicted 964
6 SASI_Hs01_00012587 predicted 1063
7 SASI_Hs01_00012588 predicted 1065
8 SASI_Hs01_00012589 predicted 957
9 SASI_Hs01_00012590 predicted 991
10 SASI_Hs01_00012592 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251182 predicted 943
2 SASI_Rn02_00251183 predicted 605
3 SASI_Rn02_00251184 predicted 368
4 SASI_Rn02_00251185 predicted 860
5 SASI_Rn02_00251186 predicted 727
6 SASI_Rn02_00251187 predicted 588
7 SASI_Rn02_00251188 predicted 223
8 SASI_Rn02_00251189 predicted 783
9 SASI_Rn02_00251190 predicted 468
10 SASI_Rn02_00251191 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023230 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030757 predicted 600
2 SASI_Mm01_00030758 predicted 726
3 SASI_Mm01_00030759 predicted 469
4 SASI_Mm01_00030760 predicted 859
5 SASI_Mm01_00030762 predicted 689
6 SASI_Mm01_00030763 predicted 509
7 SASI_Mm01_00030764 predicted 703
8 SASI_Mm02_00326982 predicted 717
9 SASI_Mm02_00326983 predicted 463
10 SASI_Mm01_00030765 predicted 712
11 SASI_Mm01_00030761 predicted 841
12 SASI_Mm01_00030766 predicted 379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021988
VALIDATED
UBE2V1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2 variant 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021988.4-460s21c1
Sequence:CCGGATTTCACTGCAAAGGAGTAAACTCGAGTTTACTCCTTTGCAGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021988.4-418s21c1
Sequence:CCGGACAAAGCAAACTGAGTGATGACTCGAGTCATCACTCAGTTTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021988.3-1409s1c1
Sequence:CCGGCCCTGGTTTCTTTAAGTCTTACTCGAGTAAGACTTAAAGAAACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021988.3-827s1c1
Sequence:CCGGCGCCTAATGATGTCTAAAGAACTCGAGTTCTTTAGACATCATTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_021988.3-755s1c1
Sequence:CCGGCCAAGAGCCATATCAGTGCTACTCGAGTAGCACTGATATGGCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021988.3-874s1c1
Sequence:CCGGAGGACAGTGTTACAGCAATTACTCGAGTAATTGCTGTAACACTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021988
VALIDATED
UBE2V1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2 variant 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021988.4-460s21c1
Sequence:CCGGATTTCACTGCAAAGGAGTAAACTCGAGTTTACTCCTTTGCAGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021988.4-418s21c1
Sequence:CCGGACAAAGCAAACTGAGTGATGACTCGAGTCATCACTCAGTTTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021988.3-1409s1c1
Sequence:CCGGCCCTGGTTTCTTTAAGTCTTACTCGAGTAAGACTTAAAGAAACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021988.3-827s1c1
Sequence:CCGGCGCCTAATGATGTCTAAAGAACTCGAGTTCTTTAGACATCATTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_021988.3-755s1c1
Sequence:CCGGCCAAGAGCCATATCAGTGCTACTCGAGTAGCACTGATATGGCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021988.3-874s1c1
Sequence:CCGGAGGACAGTGTTACAGCAATTACTCGAGTAATTGCTGTAACACTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021988
VALIDATED
UBE2V1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2 variant 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021988.4-460s21c1
Sequence:CCGGATTTCACTGCAAAGGAGTAAACTCGAGTTTACTCCTTTGCAGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021988.4-418s21c1
Sequence:CCGGACAAAGCAAACTGAGTGATGACTCGAGTCATCACTCAGTTTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021988.3-1409s1c1
Sequence:CCGGCCCTGGTTTCTTTAAGTCTTACTCGAGTAAGACTTAAAGAAACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021988.3-827s1c1
Sequence:CCGGCGCCTAATGATGTCTAAAGAACTCGAGTTCTTTAGACATCATTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_021988.3-755s1c1
Sequence:CCGGCCAAGAGCCATATCAGTGCTACTCGAGTAGCACTGATATGGCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021988.3-874s1c1
Sequence:CCGGAGGACAGTGTTACAGCAATTACTCGAGTAATTGCTGTAACACTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023230
VALIDATED
UBE2V1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2 variant 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023230.2-283s21c1
Sequence:CCGGCGTCTGTAAGATTCGTAACAACTCGAGTTGTTACGAATCTTACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023230.2-460s21c1
Sequence:CCGGCGCCGGAAGGACAGTGTTACACTCGAGTGTAACACTGTCCTTCCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023230.2-77s21c1
Sequence:CCGGCCCTCGAAATTTCCGACTGTTCTCGAGAACAGTCGGAAATTTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023230.2-230s21c1
Sequence:CCGGCCGAATATACAGCCTTAAGATCTCGAGATCTTAAGGCTGTATATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023230.2-102s21c1
Sequence:CCGGGAGCTGGAAGAAGGACAGAAACTCGAGTTTCTGTCCTTCTTCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023230.1-270s1c1
Sequence:CCGGCGTCTGTAAGATTCGTAACAACTCGAGTTGTTACGAATCTTACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023230.1-64s1c1
Sequence:CCGGCCCTCGAAATTTCCGACTGTTCTCGAGAACAGTCGGAAATTTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023230.1-217s1c1
Sequence:CCGGCCGAATATACAGCCTTAAGATCTCGAGATCTTAAGGCTGTATATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023230.1-89s1c1
Sequence:CCGGGAGCTGGAAGAAGGACAGAAACTCGAGTTTCTGTCCTTCTTCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023230.1-447s1c1
Sequence:CCGGCGCCGGAAGGACAGTGTTACACTCGAGTGTAACACTGTCCTTCCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023230
VALIDATED
UBE2V1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2 variant 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023230.2-283s21c1
Sequence:CCGGCGTCTGTAAGATTCGTAACAACTCGAGTTGTTACGAATCTTACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023230.2-460s21c1
Sequence:CCGGCGCCGGAAGGACAGTGTTACACTCGAGTGTAACACTGTCCTTCCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023230.2-77s21c1
Sequence:CCGGCCCTCGAAATTTCCGACTGTTCTCGAGAACAGTCGGAAATTTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023230.2-230s21c1
Sequence:CCGGCCGAATATACAGCCTTAAGATCTCGAGATCTTAAGGCTGTATATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023230.2-102s21c1
Sequence:CCGGGAGCTGGAAGAAGGACAGAAACTCGAGTTTCTGTCCTTCTTCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023230.1-270s1c1
Sequence:CCGGCGTCTGTAAGATTCGTAACAACTCGAGTTGTTACGAATCTTACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023230.1-64s1c1
Sequence:CCGGCCCTCGAAATTTCCGACTGTTCTCGAGAACAGTCGGAAATTTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023230.1-217s1c1
Sequence:CCGGCCGAATATACAGCCTTAAGATCTCGAGATCTTAAGGCTGTATATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023230.1-89s1c1
Sequence:CCGGGAGCTGGAAGAAGGACAGAAACTCGAGTTTCTGTCCTTCTTCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023230.1-447s1c1
Sequence:CCGGCGCCGGAAGGACAGTGTTACACTCGAGTGTAACACTGTCCTTCCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023230
VALIDATED
UBE2V1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2 variant 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023230.2-283s21c1
Sequence:CCGGCGTCTGTAAGATTCGTAACAACTCGAGTTGTTACGAATCTTACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023230.2-460s21c1
Sequence:CCGGCGCCGGAAGGACAGTGTTACACTCGAGTGTAACACTGTCCTTCCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023230.2-77s21c1
Sequence:CCGGCCCTCGAAATTTCCGACTGTTCTCGAGAACAGTCGGAAATTTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023230.2-230s21c1
Sequence:CCGGCCGAATATACAGCCTTAAGATCTCGAGATCTTAAGGCTGTATATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023230.2-102s21c1
Sequence:CCGGGAGCTGGAAGAAGGACAGAAACTCGAGTTTCTGTCCTTCTTCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023230.1-270s1c1
Sequence:CCGGCGTCTGTAAGATTCGTAACAACTCGAGTTGTTACGAATCTTACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023230.1-64s1c1
Sequence:CCGGCCCTCGAAATTTCCGACTGTTCTCGAGAACAGTCGGAAATTTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023230.1-217s1c1
Sequence:CCGGCCGAATATACAGCCTTAAGATCTCGAGATCTTAAGGCTGTATATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023230.1-89s1c1
Sequence:CCGGGAGCTGGAAGAAGGACAGAAACTCGAGTTTCTGTCCTTCTTCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023230.1-447s1c1
Sequence:CCGGCGCCGGAAGGACAGTGTTACACTCGAGTGTAACACTGTCCTTCCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks