EMAIL THIS PAGE TO A FRIEND

UBE2V2

ubiquitin-conjugating enzyme E2 variant 2

Synonyms: DDVIT1 DDVit-1 EDAF-1 EDPF-1 EDPF1 MMS2 UEV-2 UEV2
UniProtKB ID: Q15819
Gene ID:
Human(7336) Summary: Ubiquitin-conjugating enzyme E2 variant proteins constitute a distinct subfamily within the E2 protein family. They have sequence similarity to other ubiquitin-conjugating enzymes but lack the conserved cysteine residue that is critical for the catalytic activity of E2s. The protein encoded by this gene also shares homology with ubiquitin-conjugating enzyme E2 variant 1 and yeast MMS2 gene product. It may be involved in the differentiation of monocytes and enterocytes. [provided by RefSeq, Jul 2008]
Mouse(70620) ubiquitin-conjugating enzyme E2 variant 2
Rat(287927) ubiquitin-conjugating enzyme E2 variant 2
Zebrafish(406836) ubiquitin-conjugating enzyme E2 variant 2
domestic cat(101090081) ubiquitin-conjugating enzyme E2 variant 2
dog(608470) ubiquitin-conjugating enzyme E2 variant 2
chicken(421109) ubiquitin-conjugating enzyme E2 variant 2
domestic guinea pig(100721778) ubiquitin-conjugating enzyme E2 variant 2
naked mole-rat(101720592) ubiquitin-conjugating enzyme E2 variant 2
cow(286803) ubiquitin-conjugating enzyme E2 variant 2
sheep(101111640) ubiquitin-conjugating enzyme E2 variant 2
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023585 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023585 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023585 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003350 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003350 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003350 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU087761 MISSION® esiRNA esiRNA human UBE2V2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003350 Rosetta Predictions human pricing
NM_183052 Rosetta Predictions rat pricing
NM_023585 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031079 predicted 364
2 SASI_Hs01_00031080 predicted 250
3 SASI_Hs01_00031082 predicted 919
4 SASI_Hs01_00031083 predicted 871
5 SASI_Hs01_00031086 predicted 278
6 SASI_Hs01_00031085 predicted 387
7 SASI_Hs01_00031084 predicted 378
8 SASI_Hs01_00031087 predicted 482
9 SASI_Hs01_00031088 predicted 34
10 SASI_Hs01_00031081 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183052 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047658 predicted 488
2 SASI_Rn01_00047659 predicted 496
3 SASI_Rn01_00047661 predicted 206
4 SASI_Rn01_00047662 predicted 211
5 SASI_Rn01_00047663 predicted 434
6 SASI_Rn01_00047664 predicted 469
7 SASI_Rn01_00047665 predicted 565
8 SASI_Rn02_00269871 predicted 486
9 SASI_Rn01_00047666 predicted 378
10 SASI_Rn02_00269872 predicted 678
11 SASI_Rn01_00047660 predicted 684
12 SASI_Rn01_00047667 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052402 predicted 216
2 SASI_Mm01_00052404 predicted 532
3 SASI_Mm01_00052399 predicted 365
4 SASI_Mm01_00052400 predicted 503
5 SASI_Mm01_00052401 predicted 583
6 SASI_Mm01_00052403 predicted 351
7 SASI_Mm01_00052405 predicted 588
8 SASI_Mm01_00052406 predicted 516
9 SASI_Mm02_00327196 predicted 536
10 SASI_Mm02_00327197 predicted 463
11 SASI_Mm01_00052407 predicted 577
12 SASI_Mm01_00052408 predicted 692
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023585
VALIDATED
UBE2V2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2 variant 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023585.2-2674s1c1
Sequence:CCGGCCCTCAAAGATGTTCTAAATACTCGAGTATTTAGAACATCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023585.2-398s1c1
Sequence:CCGGCGTCTTATGATGTCCAAAGAACTCGAGTTCTTTGGACATCATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023585.2-219s1c1
Sequence:CCGGGCCTGAAAGTAGAATGTGGATCTCGAGATCCACATTCTACTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023585.2-171s1c1
Sequence:CCGGGCATGATTATTGGGCCACCAACTCGAGTTGGTGGCCCAATAATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023585.2-68s1c1
Sequence:CCGGCGCTTGTTGGAAGAACTTGAACTCGAGTTCAAGTTCTTCCAACAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023585.4-83s21c1
Sequence:CCGGCGCTTGTTGGAAGAACTTGAACTCGAGTTCAAGTTCTTCCAACAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023585.4-466s21c1
Sequence:CCGGGACGTACAACAACTAACTTTACTCGAGTAAAGTTAGTTGTTGTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023585.4-458s21c1
Sequence:CCGGGAAGGACAGACGTACAACAACCTCGAGGTTGTTGTACGTCTGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023585.4-242s21c1
Sequence:CCGGGTAGAATGTGGATCTAAATACCTCGAGGTATTTAGATCCACATTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023585.4-413s21c1
Sequence:CCGGCGTCTTATGATGTCCAAAGAACTCGAGTTCTTTGGACATCATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023585
VALIDATED
UBE2V2 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2 variant 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023585.2-2674s1c1
Sequence:CCGGCCCTCAAAGATGTTCTAAATACTCGAGTATTTAGAACATCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023585.2-398s1c1
Sequence:CCGGCGTCTTATGATGTCCAAAGAACTCGAGTTCTTTGGACATCATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023585.2-219s1c1
Sequence:CCGGGCCTGAAAGTAGAATGTGGATCTCGAGATCCACATTCTACTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023585.2-171s1c1
Sequence:CCGGGCATGATTATTGGGCCACCAACTCGAGTTGGTGGCCCAATAATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023585.2-68s1c1
Sequence:CCGGCGCTTGTTGGAAGAACTTGAACTCGAGTTCAAGTTCTTCCAACAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023585.4-83s21c1
Sequence:CCGGCGCTTGTTGGAAGAACTTGAACTCGAGTTCAAGTTCTTCCAACAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023585.4-466s21c1
Sequence:CCGGGACGTACAACAACTAACTTTACTCGAGTAAAGTTAGTTGTTGTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023585.4-458s21c1
Sequence:CCGGGAAGGACAGACGTACAACAACCTCGAGGTTGTTGTACGTCTGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023585.4-242s21c1
Sequence:CCGGGTAGAATGTGGATCTAAATACCTCGAGGTATTTAGATCCACATTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023585.4-413s21c1
Sequence:CCGGCGTCTTATGATGTCCAAAGAACTCGAGTTCTTTGGACATCATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023585
VALIDATED
UBE2V2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2 variant 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023585.2-2674s1c1
Sequence:CCGGCCCTCAAAGATGTTCTAAATACTCGAGTATTTAGAACATCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023585.2-398s1c1
Sequence:CCGGCGTCTTATGATGTCCAAAGAACTCGAGTTCTTTGGACATCATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023585.2-219s1c1
Sequence:CCGGGCCTGAAAGTAGAATGTGGATCTCGAGATCCACATTCTACTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023585.2-171s1c1
Sequence:CCGGGCATGATTATTGGGCCACCAACTCGAGTTGGTGGCCCAATAATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023585.2-68s1c1
Sequence:CCGGCGCTTGTTGGAAGAACTTGAACTCGAGTTCAAGTTCTTCCAACAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023585.4-83s21c1
Sequence:CCGGCGCTTGTTGGAAGAACTTGAACTCGAGTTCAAGTTCTTCCAACAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023585.4-466s21c1
Sequence:CCGGGACGTACAACAACTAACTTTACTCGAGTAAAGTTAGTTGTTGTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023585.4-458s21c1
Sequence:CCGGGAAGGACAGACGTACAACAACCTCGAGGTTGTTGTACGTCTGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023585.4-242s21c1
Sequence:CCGGGTAGAATGTGGATCTAAATACCTCGAGGTATTTAGATCCACATTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023585.4-413s21c1
Sequence:CCGGCGTCTTATGATGTCCAAAGAACTCGAGTTCTTTGGACATCATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003350
VALIDATED
UBE2V2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2 variant 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003350.x-319s1c1
Sequence:CCGGGCCCGGAGCATACCAGTGTTACTCGAGTAACACTGGTATGCTCCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003350.x-152s1c1
Sequence:CCGGCAAGGTGGACAGGCATGATTACTCGAGTAATCATGCCTGTCCACCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003350.x-434s1c1
Sequence:CCGGCAGAAGGACAAACATACAACACTCGAGTGTTGTATGTTTGTCCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004036    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003350.x-480s1c1
Sequence:CCGGGTCTTAAATCAACAACCTTCTCTCGAGAGAAGGTTGTTGATTTAAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003350.x-247s1c1
Sequence:CCGGGCTCCTCCGTCAGTTAGATTTCTCGAGAAATCTAACTGACGGAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003350.2-152s21c1
Sequence:CCGGCAAGGTGGACAGGCATGATTACTCGAGTAATCATGCCTGTCCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003350.2-247s21c1
Sequence:CCGGGCTCCTCCGTCAGTTAGATTTCTCGAGAAATCTAACTGACGGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003350.2-480s21c1
Sequence:CCGGGTCTTAAATCAACAACCTTCTCTCGAGAGAAGGTTGTTGATTTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003350.2-175s21c1
Sequence:CCGGGGGCCACCAAGGACAAATTATCTCGAGATAATTTGTCCTTGGTGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003350.2-378s21c1
Sequence:CCGGTCAAGAGCTAAGACGTCTAATCTCGAGATTAGACGTCTTAGCTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003350
VALIDATED
UBE2V2 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2 variant 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003350.x-319s1c1
Sequence:CCGGGCCCGGAGCATACCAGTGTTACTCGAGTAACACTGGTATGCTCCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003350.x-152s1c1
Sequence:CCGGCAAGGTGGACAGGCATGATTACTCGAGTAATCATGCCTGTCCACCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003350.x-434s1c1
Sequence:CCGGCAGAAGGACAAACATACAACACTCGAGTGTTGTATGTTTGTCCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004036    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003350.x-480s1c1
Sequence:CCGGGTCTTAAATCAACAACCTTCTCTCGAGAGAAGGTTGTTGATTTAAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003350.x-247s1c1
Sequence:CCGGGCTCCTCCGTCAGTTAGATTTCTCGAGAAATCTAACTGACGGAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003350.2-152s21c1
Sequence:CCGGCAAGGTGGACAGGCATGATTACTCGAGTAATCATGCCTGTCCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003350.2-247s21c1
Sequence:CCGGGCTCCTCCGTCAGTTAGATTTCTCGAGAAATCTAACTGACGGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003350.2-480s21c1
Sequence:CCGGGTCTTAAATCAACAACCTTCTCTCGAGAGAAGGTTGTTGATTTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003350.2-175s21c1
Sequence:CCGGGGGCCACCAAGGACAAATTATCTCGAGATAATTTGTCCTTGGTGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003350.2-378s21c1
Sequence:CCGGTCAAGAGCTAAGACGTCTAATCTCGAGATTAGACGTCTTAGCTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003350
VALIDATED
UBE2V2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2 variant 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003350.x-319s1c1
Sequence:CCGGGCCCGGAGCATACCAGTGTTACTCGAGTAACACTGGTATGCTCCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003350.x-152s1c1
Sequence:CCGGCAAGGTGGACAGGCATGATTACTCGAGTAATCATGCCTGTCCACCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003350.x-434s1c1
Sequence:CCGGCAGAAGGACAAACATACAACACTCGAGTGTTGTATGTTTGTCCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004036    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003350.x-480s1c1
Sequence:CCGGGTCTTAAATCAACAACCTTCTCTCGAGAGAAGGTTGTTGATTTAAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003350.x-247s1c1
Sequence:CCGGGCTCCTCCGTCAGTTAGATTTCTCGAGAAATCTAACTGACGGAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003350.2-152s21c1
Sequence:CCGGCAAGGTGGACAGGCATGATTACTCGAGTAATCATGCCTGTCCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003350.2-247s21c1
Sequence:CCGGGCTCCTCCGTCAGTTAGATTTCTCGAGAAATCTAACTGACGGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003350.2-480s21c1
Sequence:CCGGGTCTTAAATCAACAACCTTCTCTCGAGAGAAGGTTGTTGATTTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003350.2-175s21c1
Sequence:CCGGGGGCCACCAAGGACAAATTATCTCGAGATAATTTGTCCTTGGTGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003350.2-378s21c1
Sequence:CCGGTCAAGAGCTAAGACGTCTAATCTCGAGATTAGACGTCTTAGCTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks