EMAIL THIS PAGE TO A FRIEND

UBE2W

ubiquitin-conjugating enzyme E2W (putative)

Synonyms: UBC-16 UBC16
UniProtKB ID: Q96B02, B4DIV1, Q1XBE0, Q9H823, Q9HAG6, Q9NV07
Gene ID:
Human(55284) Summary: This gene encodes a nuclear-localized ubiquitin-conjugating enzyme (E2) that, along with ubiquitin-activating (E1) and ligating (E3) enzymes, coordinates the addition of a ubiquitin moiety to existing proteins. The encoded protein promotes the ubiquitination of Fanconi anemia complementation group proteins and may be important in the repair of DNA damage. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Mouse(66799) ubiquitin-conjugating enzyme E2W (putative)
Rat(100909445) ubiquitin-conjugating enzyme E2W
Zebrafish(553013) ubiquitin-conjugating enzyme E2W (putative)
dog(486999) ubiquitin-conjugating enzyme E2W (putative)
domestic cat(101100361) ubiquitin-conjugating enzyme E2W (putative)
chicken(420185) ubiquitin-conjugating enzyme E2W (putative)
cow(613423) ubiquitin-conjugating enzyme E2W (putative)
sheep(101107531) ubiquitin-conjugating enzyme E2W (putative)
naked mole-rat(101724035) ubiquitin-conjugating enzyme E2W (putative)
domestic guinea pig(100730250) ubiquitin-conjugating enzyme E2W (putative)
252 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018299 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018299 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018299 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025773 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025773 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025773 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001481 Rosetta Predictions human pricing
NM_001001482 Rosetta Predictions human pricing
NM_018299 Rosetta Predictions human pricing
NM_025773 Rosetta Predictions mouse pricing
XM_484835 Rosetta Predictions mouse pricing
XM_886402 Rosetta Predictions mouse pricing
XM_896807 Rosetta Predictions mouse pricing
XM_896814 Rosetta Predictions mouse pricing
XM_896827 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303787 predicted 483
2 SASI_Hs02_00303788 predicted 392
3 SASI_Hs01_00231191 predicted 1039
4 SASI_Hs01_00231192 predicted 405
5 SASI_Hs01_00231195 predicted 530
6 SASI_Hs01_00231197 predicted 617
7 SASI_Hs01_00231198 predicted 513
8 SASI_Hs01_00231199 predicted 150
9 SASI_Hs01_00231200 predicted 517
10 SASI_Hs02_00303789 predicted 143
11 SASI_Hs01_00231193 predicted 601
12 SASI_Hs01_00231194 predicted 353
13 SASI_Hs01_00231196 predicted 146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161579 predicted 275
2 SASI_Hs01_00161580 predicted 455
3 SASI_Hs01_00161581 predicted 215
4 SASI_Hs01_00161582 predicted 400
5 SASI_Hs01_00161583 predicted 119
6 SASI_Hs01_00161584 predicted 486
7 SASI_Hs01_00161585 predicted 382
8 SASI_Hs01_00161586 predicted 121
9 SASI_Hs01_00161587 predicted 386
10 SASI_Hs01_00161588 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226093 predicted 451
2 SASI_Hs01_00226094 predicted 368
3 SASI_Hs01_00226085 predicted 1003
4 SASI_Hs01_00226086 predicted 376
5 SASI_Hs01_00226089 predicted 492
6 SASI_Hs01_00226090 predicted 582
7 SASI_Hs01_00226091 predicted 484
8 SASI_Hs02_00351702 predicted 116
9 SASI_Hs02_00351703 predicted 475
10 SASI_Hs02_00351704 predicted 113
11 SASI_Hs01_00226087 predicted 562
12 SASI_Hs01_00226088 predicted 324
13 SASI_Hs01_00226092 predicted 119
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025773 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328975 predicted 296
2 SASI_Mm02_00328976 predicted 457
3 SASI_Mm02_00328977 predicted 977
4 SASI_Mm02_00328978 predicted 290
5 SASI_Mm02_00328979 predicted 59
6 SASI_Mm02_00328980 predicted 585
7 SASI_Mm02_00328981 predicted 563
8 SASI_Mm02_00328982 predicted 39
9 SASI_Mm02_00328983 predicted 531
10 SASI_Mm02_00328984 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207668 predicted 696
2 SASI_Mm01_00207669 predicted 675
3 SASI_Mm01_00207670 predicted 319
4 SASI_Mm01_00207671 predicted 658
5 SASI_Mm01_00207672 predicted 751
6 SASI_Mm01_00207673 predicted 548
7 SASI_Mm01_00207674 predicted 685
8 SASI_Mm01_00207675 predicted 727
9 SASI_Mm01_00207676 predicted 520
10 SASI_Mm01_00207677 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_886402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224683 predicted 355
2 SASI_Mm01_00224684 predicted 290
3 SASI_Mm01_00224685 predicted 478
4 SASI_Mm01_00224686 predicted 424
5 SASI_Mm01_00224687 predicted 526
6 SASI_Mm01_00224688 predicted 456
7 SASI_Mm01_00224689 predicted 351
8 SASI_Mm01_00224690 predicted 329
9 SASI_Mm01_00224691 predicted 398
10 SASI_Mm01_00224692 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229195 predicted 720
2 SASI_Mm01_00229196 predicted 651
3 SASI_Mm01_00229197 predicted 746
4 SASI_Mm01_00229198 predicted 706
5 SASI_Mm01_00229199 predicted 708
6 SASI_Mm01_00229200 predicted 712
7 SASI_Mm01_00229201 predicted 677
8 SASI_Mm01_00229202 predicted 815
9 SASI_Mm01_00229203 predicted 765
10 SASI_Mm01_00229204 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236473 predicted 361
2 SASI_Mm01_00236474 predicted 289
3 SASI_Mm01_00236475 predicted 476
4 SASI_Mm01_00236476 predicted 430
5 SASI_Mm01_00236477 predicted 449
6 SASI_Mm01_00236478 predicted 354
7 SASI_Mm01_00236479 predicted 322
8 SASI_Mm01_00236480 predicted 397
9 SASI_Mm01_00236481 predicted 344
10 SASI_Mm01_00236482 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896827 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224252 predicted 387
2 SASI_Mm01_00224253 predicted 912
3 SASI_Mm01_00224254 predicted 65
4 SASI_Mm01_00224255 predicted 513
5 SASI_Mm01_00224256 predicted 882
6 SASI_Mm01_00224257 predicted 295
7 SASI_Mm01_00224258 predicted 511
8 SASI_Mm01_00224259 predicted 499
9 SASI_Mm01_00224260 predicted 38
10 SASI_Mm01_00224261 predicted 453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018299
VALIDATED
UBE2W MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2W (putative)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297766    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018299.3-1054s21c1
Sequence:CCGGGCATGAATTAACATGCGTCTTCTCGAGAAGACGCATGTTAATTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018299.3-418s21c1
Sequence:CCGGAGAGACGACCACCGGATAATTCTCGAGAATTATCCGGTGGTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018299.3-111s21c1
Sequence:CCGGCCTCCTGGAATGACCTTAAATCTCGAGATTTAAGGTCATTCCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018299.3-358s21c1
Sequence:CCGGCGCTCTCAGTCCAATCAGTTTCTCGAGAAACTGATTGGACTGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018299.3-294s21c1
Sequence:CCGGCATCCTCATGTTTATAGCAATCTCGAGATTGCTATAAACATGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018299.1-1004s1c1
Sequence:CCGGGCATGAATTAACATGCGTCTTCTCGAGAAGACGCATGTTAATTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018299.1-61s1c1
Sequence:CCGGCCTCCTGGAATGACCTTAAATCTCGAGATTTAAGGTCATTCCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018299.1-211s1c1
Sequence:CCGGCAGGTCATGTTTACTGGTGAACTCGAGTTCACCAGTAAACATGACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018299.1-244s1c1
Sequence:CCGGCATCCTCATGTTTATAGCAATCTCGAGATTGCTATAAACATGAGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018299.1-308s1c1
Sequence:CCGGCGCTCTCAGTCCAATCAGTTTCTCGAGAAACTGATTGGACTGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018299
VALIDATED
UBE2W MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2W (putative)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297766    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018299.3-1054s21c1
Sequence:CCGGGCATGAATTAACATGCGTCTTCTCGAGAAGACGCATGTTAATTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018299.3-418s21c1
Sequence:CCGGAGAGACGACCACCGGATAATTCTCGAGAATTATCCGGTGGTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018299.3-111s21c1
Sequence:CCGGCCTCCTGGAATGACCTTAAATCTCGAGATTTAAGGTCATTCCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018299.3-358s21c1
Sequence:CCGGCGCTCTCAGTCCAATCAGTTTCTCGAGAAACTGATTGGACTGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018299.3-294s21c1
Sequence:CCGGCATCCTCATGTTTATAGCAATCTCGAGATTGCTATAAACATGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018299.1-1004s1c1
Sequence:CCGGGCATGAATTAACATGCGTCTTCTCGAGAAGACGCATGTTAATTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018299.1-61s1c1
Sequence:CCGGCCTCCTGGAATGACCTTAAATCTCGAGATTTAAGGTCATTCCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018299.1-211s1c1
Sequence:CCGGCAGGTCATGTTTACTGGTGAACTCGAGTTCACCAGTAAACATGACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018299.1-244s1c1
Sequence:CCGGCATCCTCATGTTTATAGCAATCTCGAGATTGCTATAAACATGAGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018299.1-308s1c1
Sequence:CCGGCGCTCTCAGTCCAATCAGTTTCTCGAGAAACTGATTGGACTGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018299
VALIDATED
UBE2W MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2W (putative)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297766    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018299.3-1054s21c1
Sequence:CCGGGCATGAATTAACATGCGTCTTCTCGAGAAGACGCATGTTAATTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018299.3-418s21c1
Sequence:CCGGAGAGACGACCACCGGATAATTCTCGAGAATTATCCGGTGGTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018299.3-111s21c1
Sequence:CCGGCCTCCTGGAATGACCTTAAATCTCGAGATTTAAGGTCATTCCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018299.3-358s21c1
Sequence:CCGGCGCTCTCAGTCCAATCAGTTTCTCGAGAAACTGATTGGACTGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018299.3-294s21c1
Sequence:CCGGCATCCTCATGTTTATAGCAATCTCGAGATTGCTATAAACATGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018299.1-1004s1c1
Sequence:CCGGGCATGAATTAACATGCGTCTTCTCGAGAAGACGCATGTTAATTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018299.1-61s1c1
Sequence:CCGGCCTCCTGGAATGACCTTAAATCTCGAGATTTAAGGTCATTCCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018299.1-211s1c1
Sequence:CCGGCAGGTCATGTTTACTGGTGAACTCGAGTTCACCAGTAAACATGACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018299.1-244s1c1
Sequence:CCGGCATCCTCATGTTTATAGCAATCTCGAGATTGCTATAAACATGAGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018299.1-308s1c1
Sequence:CCGGCGCTCTCAGTCCAATCAGTTTCTCGAGAAACTGATTGGACTGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025773
VALIDATED
UBE2W MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2W (putative)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025773.2-284s21c1
Sequence:CCGGTGTGTATAGCAATGGTCATATCTCGAGATATGACCATTGCTATACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025773.2-400s21c1
Sequence:CCGGAGAGACGACCACCAGATAATTCTCGAGAATTATCTGGTGGTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025773.2-162s21c1
Sequence:CCGGGGTGCACCAGGAACCTTATATCTCGAGATATAAGGTTCCTGGTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025773.2-430s21c1
Sequence:CCGGTGCGAACATGTAACAAGAATCCTCGAGGATTCTTGTTACATGTTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025773.2-839s21c1
Sequence:CCGGGCCGGCAATGGACGTTGTAAACTCGAGTTTACAACGTCCATTGCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025773
VALIDATED
UBE2W MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2W (putative)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025773.2-284s21c1
Sequence:CCGGTGTGTATAGCAATGGTCATATCTCGAGATATGACCATTGCTATACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025773.2-400s21c1
Sequence:CCGGAGAGACGACCACCAGATAATTCTCGAGAATTATCTGGTGGTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025773.2-162s21c1
Sequence:CCGGGGTGCACCAGGAACCTTATATCTCGAGATATAAGGTTCCTGGTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025773.2-430s21c1
Sequence:CCGGTGCGAACATGTAACAAGAATCCTCGAGGATTCTTGTTACATGTTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025773.2-839s21c1
Sequence:CCGGGCCGGCAATGGACGTTGTAAACTCGAGTTTACAACGTCCATTGCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025773
VALIDATED
UBE2W MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2W (putative)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025773.2-284s21c1
Sequence:CCGGTGTGTATAGCAATGGTCATATCTCGAGATATGACCATTGCTATACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025773.2-400s21c1
Sequence:CCGGAGAGACGACCACCAGATAATTCTCGAGAATTATCTGGTGGTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025773.2-162s21c1
Sequence:CCGGGGTGCACCAGGAACCTTATATCTCGAGATATAAGGTTCCTGGTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025773.2-430s21c1
Sequence:CCGGTGCGAACATGTAACAAGAATCCTCGAGGATTCTTGTTACATGTTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025773.2-839s21c1
Sequence:CCGGGCCGGCAATGGACGTTGTAAACTCGAGTTTACAACGTCCATTGCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks