EMAIL THIS PAGE TO A FRIEND

UBE2Z

ubiquitin-conjugating enzyme E2Z

Synonyms: USE1
UniProtKB ID: Q9H832, A6N8M6, A6NC60, Q7L354, Q8TCM4, Q9H893
Gene ID:
Human(65264) Summary: This gene encodes an enzyme which ubiquitinates proteins which participate in signaling pathways and apoptosis. [provided by RefSeq, Feb 2012]
Mouse(268470) ubiquitin-conjugating enzyme E2Z (putative)
Rat(303478) ubiquitin-conjugating enzyme E2Z
Zebrafish(436602) ubiquitin-conjugating enzyme E2Z
dog(491062) ubiquitin-conjugating enzyme E2Z
chicken(419991) ubiquitin-conjugating enzyme E2Z
domestic cat(101080843) ubiquitin-conjugating enzyme E2Z
domestic guinea pig(100718845) ubiquitin-conjugating enzyme E2Z
naked mole-rat(101718509) ubiquitin-conjugating enzyme E2Z
cow(100138178) ubiquitin-conjugating enzyme E2Z
sheep(101119836) ubiquitin-conjugating enzyme E2Z
169 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023079 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023079 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023079 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172300 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172300 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172300 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063691 MISSION® esiRNA esiRNA human UBE2Z (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023079 Rosetta Predictions human pricing
NM_001037643 Rosetta Predictions rat pricing
NM_172300 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048090 predicted 472
2 SASI_Hs01_00048091 predicted 817
3 SASI_Hs01_00048092 predicted 646
4 SASI_Hs01_00048093 predicted 1091
5 SASI_Hs01_00048094 predicted 610
6 SASI_Hs01_00048095 predicted 489
7 SASI_Hs01_00048096 predicted 1086
8 SASI_Hs01_00048097 predicted 590
9 SASI_Hs02_00356327 predicted 869
10 SASI_Hs02_00356328 predicted 766
11 SASI_Hs01_00048098 predicted 417
12 SASI_Hs01_00048099 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204513 predicted 696
2 SASI_Rn01_00084178 predicted 766
3 SASI_Rn01_00084179 predicted 870
4 SASI_Rn01_00084180 predicted 1413
5 SASI_Rn01_00084181 predicted 550
6 SASI_Rn01_00084182 predicted 440
7 SASI_Rn01_00084183 predicted 1406
8 SASI_Rn01_00084184 predicted 538
9 SASI_Rn01_00084185 predicted 455
10 SASI_Rn01_00084186 predicted 551
11 SASI_Rn01_00084187 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172300 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068615 predicted 1449
2 SASI_Mm02_00343786 predicted 742
3 SASI_Mm01_00068617 predicted 600
4 SASI_Mm01_00068618 predicted 483
5 SASI_Mm01_00068620 predicted 589
6 SASI_Mm02_00343787 predicted 774
7 SASI_Mm02_00343788 predicted 1448
8 SASI_Mm02_00343789 predicted 964
9 SASI_Mm02_00343790 predicted 1088
10 SASI_Mm01_00068623 predicted 1454
11 SASI_Mm01_00068614 predicted 917
12 SASI_Mm01_00068616 predicted 503
13 SASI_Mm01_00068619 predicted 1499
14 SASI_Mm01_00068621 predicted 1579
15 SASI_Mm01_00068622 predicted 1566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023079
VALIDATED
UBE2Z MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2Z
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023079.2-2212s1c1
Sequence:CCGGCCTGGCTTTGTTGCTTCTCTACTCGAGTAGAGAAGCAACAAAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023079.2-884s1c1
Sequence:CCGGGCCAAACTATGCAGGACCCTTCTCGAGAAGGGTCCTGCATAGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023079.2-736s1c1
Sequence:CCGGCGGCACGAGACCATCAGAGTTCTCGAGAACTCTGATGGTCTCGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023079.2-563s1c1
Sequence:CCGGTCTGCTTGAGTATTCTAGGTACTCGAGTACCTAGAATACTCAAGCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023079.2-498s1c1
Sequence:CCGGCAAACTGATGACAACGGGCAACTCGAGTTGCCCGTTGTCATCAGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023079.3-497s21c1
Sequence:CCGGCATTGATCACAGGCCCATTTGCTCGAGCAAATGGGCCTGTGATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023079.3-2308s21c1
Sequence:CCGGCCTGGCTTTGTTGCTTCTCTACTCGAGTAGAGAAGCAACAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023079.3-597s21c1
Sequence:CCGGACTGATGACAACGGGCAATAACTCGAGTTATTGCCCGTTGTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023079.3-536s21c1
Sequence:CCGGGTTTCTTCCTGTTCGTGTTTCCTCGAGGAAACACGAACAGGAAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023079.3-414s21c1
Sequence:CCGGGCGGGATATCATGTCCATTTACTCGAGTAAATGGACATGATATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023079
VALIDATED
UBE2Z MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2Z
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023079.2-2212s1c1
Sequence:CCGGCCTGGCTTTGTTGCTTCTCTACTCGAGTAGAGAAGCAACAAAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023079.2-884s1c1
Sequence:CCGGGCCAAACTATGCAGGACCCTTCTCGAGAAGGGTCCTGCATAGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023079.2-736s1c1
Sequence:CCGGCGGCACGAGACCATCAGAGTTCTCGAGAACTCTGATGGTCTCGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023079.2-563s1c1
Sequence:CCGGTCTGCTTGAGTATTCTAGGTACTCGAGTACCTAGAATACTCAAGCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023079.2-498s1c1
Sequence:CCGGCAAACTGATGACAACGGGCAACTCGAGTTGCCCGTTGTCATCAGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023079.3-497s21c1
Sequence:CCGGCATTGATCACAGGCCCATTTGCTCGAGCAAATGGGCCTGTGATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023079.3-2308s21c1
Sequence:CCGGCCTGGCTTTGTTGCTTCTCTACTCGAGTAGAGAAGCAACAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023079.3-597s21c1
Sequence:CCGGACTGATGACAACGGGCAATAACTCGAGTTATTGCCCGTTGTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023079.3-536s21c1
Sequence:CCGGGTTTCTTCCTGTTCGTGTTTCCTCGAGGAAACACGAACAGGAAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023079.3-414s21c1
Sequence:CCGGGCGGGATATCATGTCCATTTACTCGAGTAAATGGACATGATATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023079
VALIDATED
UBE2Z MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2Z
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023079.2-2212s1c1
Sequence:CCGGCCTGGCTTTGTTGCTTCTCTACTCGAGTAGAGAAGCAACAAAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023079.2-884s1c1
Sequence:CCGGGCCAAACTATGCAGGACCCTTCTCGAGAAGGGTCCTGCATAGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023079.2-736s1c1
Sequence:CCGGCGGCACGAGACCATCAGAGTTCTCGAGAACTCTGATGGTCTCGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023079.2-563s1c1
Sequence:CCGGTCTGCTTGAGTATTCTAGGTACTCGAGTACCTAGAATACTCAAGCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023079.2-498s1c1
Sequence:CCGGCAAACTGATGACAACGGGCAACTCGAGTTGCCCGTTGTCATCAGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023079.3-497s21c1
Sequence:CCGGCATTGATCACAGGCCCATTTGCTCGAGCAAATGGGCCTGTGATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023079.3-2308s21c1
Sequence:CCGGCCTGGCTTTGTTGCTTCTCTACTCGAGTAGAGAAGCAACAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023079.3-597s21c1
Sequence:CCGGACTGATGACAACGGGCAATAACTCGAGTTATTGCCCGTTGTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023079.3-536s21c1
Sequence:CCGGGTTTCTTCCTGTTCGTGTTTCCTCGAGGAAACACGAACAGGAAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023079.3-414s21c1
Sequence:CCGGGCGGGATATCATGTCCATTTACTCGAGTAAATGGACATGATATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172300
VALIDATED
UBE2Z MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2Z
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172300.2-920s1c1
Sequence:CCGGCCTGGAGTATTATGACTTCTACTCGAGTAGAAGTCATAATACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172300.2-463s1c1
Sequence:CCGGCCGACACTGTTGACATGACTACTCGAGTAGTCATGTCAACAGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172300.2-410s1c1
Sequence:CCGGCGGGATATCATGTCCATTTATCTCGAGATAAATGGACATGATATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172300.2-965s1c1
Sequence:CCGGGCATCTTCAAGGCCAAACTATCTCGAGATAGTTTGGCCTTGAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172300.2-583s1c1
Sequence:CCGGCTCGGGTCAAACTGATGACAACTCGAGTTGTCATCAGTTTGACCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172300.3-921s21c1
Sequence:CCGGCCTGGAGTATTATGACTTCTACTCGAGTAGAAGTCATAATACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172300.3-1444s21c1
Sequence:CCGGCTCTGCAGGGCCAGCTAATTACTCGAGTAATTAGCTGGCCCTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172300.3-390s21c1
Sequence:CCGGACAGTGTCTACTTCGGATTAACTCGAGTTAATCCGAAGTAGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172300.3-464s21c1
Sequence:CCGGCCGACACTGTTGACATGACTACTCGAGTAGTCATGTCAACAGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172300.3-412s21c1
Sequence:CCGGCGGGATATCATGTCCATTTATCTCGAGATAAATGGACATGATATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172300
VALIDATED
UBE2Z MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2Z
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172300.2-920s1c1
Sequence:CCGGCCTGGAGTATTATGACTTCTACTCGAGTAGAAGTCATAATACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172300.2-463s1c1
Sequence:CCGGCCGACACTGTTGACATGACTACTCGAGTAGTCATGTCAACAGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172300.2-410s1c1
Sequence:CCGGCGGGATATCATGTCCATTTATCTCGAGATAAATGGACATGATATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172300.2-965s1c1
Sequence:CCGGGCATCTTCAAGGCCAAACTATCTCGAGATAGTTTGGCCTTGAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172300.2-583s1c1
Sequence:CCGGCTCGGGTCAAACTGATGACAACTCGAGTTGTCATCAGTTTGACCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172300.3-921s21c1
Sequence:CCGGCCTGGAGTATTATGACTTCTACTCGAGTAGAAGTCATAATACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172300.3-1444s21c1
Sequence:CCGGCTCTGCAGGGCCAGCTAATTACTCGAGTAATTAGCTGGCCCTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172300.3-390s21c1
Sequence:CCGGACAGTGTCTACTTCGGATTAACTCGAGTTAATCCGAAGTAGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172300.3-464s21c1
Sequence:CCGGCCGACACTGTTGACATGACTACTCGAGTAGTCATGTCAACAGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172300.3-412s21c1
Sequence:CCGGCGGGATATCATGTCCATTTATCTCGAGATAAATGGACATGATATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172300
VALIDATED
UBE2Z MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2Z
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172300.2-920s1c1
Sequence:CCGGCCTGGAGTATTATGACTTCTACTCGAGTAGAAGTCATAATACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172300.2-463s1c1
Sequence:CCGGCCGACACTGTTGACATGACTACTCGAGTAGTCATGTCAACAGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172300.2-410s1c1
Sequence:CCGGCGGGATATCATGTCCATTTATCTCGAGATAAATGGACATGATATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172300.2-965s1c1
Sequence:CCGGGCATCTTCAAGGCCAAACTATCTCGAGATAGTTTGGCCTTGAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172300.2-583s1c1
Sequence:CCGGCTCGGGTCAAACTGATGACAACTCGAGTTGTCATCAGTTTGACCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172300.3-921s21c1
Sequence:CCGGCCTGGAGTATTATGACTTCTACTCGAGTAGAAGTCATAATACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172300.3-1444s21c1
Sequence:CCGGCTCTGCAGGGCCAGCTAATTACTCGAGTAATTAGCTGGCCCTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172300.3-390s21c1
Sequence:CCGGACAGTGTCTACTTCGGATTAACTCGAGTTAATCCGAAGTAGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172300.3-464s21c1
Sequence:CCGGCCGACACTGTTGACATGACTACTCGAGTAGTCATGTCAACAGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172300.3-412s21c1
Sequence:CCGGCGGGATATCATGTCCATTTATCTCGAGATAAATGGACATGATATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks