EMAIL THIS PAGE TO A FRIEND

UBE3A

ubiquitin protein ligase E3A

Synonyms: ANCR AS E6-AP EPVE6AP HPVE6A
Gene ID:
Human(7337) Summary: This gene encodes an E3 ubiquitin-protein ligase, part of the ubiquitin protein degradation system. This imprinted gene is maternally expressed in brain and biallelically expressed in other tissues. Maternally inherited deletion of this gene causes Angelman Syndrome, characterized by severe motor and intellectual retardation, ataxia, hypotonia, epilepsy, absence of speech, and characteristic facies. The protein also interacts with the E6 protein of human papillomavirus types 16 and 18, resulting in ubiquitination and proteolysis of tumor protein p53. Alternative splicing of this gene results in three transcript variants encoding three isoforms with different N-termini. Additional transcript variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(22215) ubiquitin protein ligase E3A
Rat(361585) ubiquitin protein ligase E3A
cow(533136) ubiquitin protein ligase E3A
sheep(101114391) ubiquitin protein ligase E3A
naked mole-rat(101709173) ubiquitin protein ligase E3A
Domestic Rabbit(100342825) ubiquitin protein ligase E3A
domestic guinea pig(100730511) ubiquitin protein ligase E3A
fruit fly(39266) Ubiquitin protein ligase E3A
Horse(100050725) ubiquitin protein ligase E3A
domestic cat(101089941) ubiquitin protein ligase E3A
dog(479010) ubiquitin protein ligase E3A
Zebrafish(792398) ubiquitin protein ligase E3A
chicken(418686) ubiquitin protein ligase E3A
269 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000462 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000462 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000462 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011668 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011668 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011668 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113061 MISSION® esiRNA esiRNA human UBE3A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000462 Rosetta Predictions human pricing
NM_130838 Rosetta Predictions human pricing
NM_130839 Rosetta Predictions human pricing
XM_001055915 Rosetta Predictions rat pricing
XM_341867 Rosetta Predictions rat pricing
NM_001033962 Rosetta Predictions mouse pricing
NM_011668 Rosetta Predictions mouse pricing
NM_173010 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220607 predicted 1874
2 SASI_Hs02_00302604 predicted 686
3 SASI_Hs01_00220609 predicted 281
4 SASI_Hs01_00220610 predicted 2226
5 SASI_Hs01_00220611 predicted 1562
6 SASI_Hs02_00302605 predicted 1767
7 SASI_Hs02_00302606 predicted 2255
8 SASI_Hs01_00220613 predicted 1049
9 SASI_Hs01_00220614 predicted 726
10 SASI_Hs02_00302607 predicted 1859
11 SASI_Hs01_00220608 predicted 853
12 SASI_Hs01_00220612 predicted 401
13 SASI_Hs01_00220615 predicted 835
14 SASI_Hs01_00220616 predicted 1847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066467 predicted 1850
2 SASI_Hs02_00362874 predicted 661
3 SASI_Hs01_00066469 predicted 252
4 SASI_Hs01_00066470 predicted 2199
5 SASI_Hs01_00066471 predicted 1540
6 SASI_Hs02_00362875 predicted 1740
7 SASI_Hs02_00362876 predicted 2226
8 SASI_Hs01_00066473 predicted 1027
9 SASI_Hs01_00066474 predicted 698
10 SASI_Hs02_00362877 predicted 1835
11 SASI_Hs01_00066468 predicted 825
12 SASI_Hs01_00066472 predicted 374
13 SASI_Hs01_00066475 predicted 811
14 SASI_Hs01_00066476 predicted 1818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030645 predicted 2521
2 SASI_Hs02_00362878 predicted 1334
3 SASI_Hs01_00030647 predicted 927
4 SASI_Hs01_00030648 predicted 2867
5 SASI_Hs01_00030649 predicted 2210
6 SASI_Hs02_00362879 predicted 2416
7 SASI_Hs02_00362880 predicted 2901
8 SASI_Hs01_00030651 predicted 1701
9 SASI_Hs01_00030652 predicted 1371
10 SASI_Hs02_00362881 predicted 2503
11 SASI_Hs01_00030646 predicted 1503
12 SASI_Hs01_00030650 predicted 1043
13 SASI_Hs01_00030653 predicted 1481
14 SASI_Hs01_00030654 predicted 2495
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055915 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281389 predicted 513
2 SASI_Rn02_00281390 predicted 2365
3 SASI_Rn02_00281391 predicted 1876
4 SASI_Rn02_00281392 predicted 2321
5 SASI_Rn02_00281393 predicted 2258
6 SASI_Rn02_00281394 predicted 709
7 SASI_Rn02_00281395 predicted 803
8 SASI_Rn02_00281396 predicted 1860
9 SASI_Rn02_00281397 predicted 1196
10 SASI_Rn02_00281398 predicted 2215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393523 predicted 512
2 SASI_Rn02_00393524 predicted 2368
3 SASI_Rn02_00393525 predicted 1871
4 SASI_Rn02_00393526 predicted 2321
5 SASI_Rn02_00393527 predicted 2255
6 SASI_Rn02_00393528 predicted 702
7 SASI_Rn02_00393529 predicted 796
8 SASI_Rn02_00393530 predicted 1855
9 SASI_Rn02_00393531 predicted 1189
10 SASI_Rn02_00393532 predicted 2210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033962 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289046 predicted 2239
2 SASI_Mm01_00068804 predicted 803
3 SASI_Mm01_00068805 predicted 1514
4 SASI_Mm01_00068807 predicted 1189
5 SASI_Mm02_00289047 predicted 2342
6 SASI_Mm01_00068809 predicted 2055
7 SASI_Mm01_00068810 predicted 2172
8 SASI_Mm01_00068811 predicted 1319
9 SASI_Mm01_00068812 predicted 1971
10 SASI_Mm02_00289048 predicted 996
11 SASI_Mm01_00068806 predicted 1557
12 SASI_Mm01_00068808 predicted 1869
13 SASI_Mm01_00068813 predicted 2262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321180 predicted 2423
2 SASI_Mm01_00126127 predicted 985
3 SASI_Mm01_00126128 predicted 1706
4 SASI_Mm01_00126130 predicted 1383
5 SASI_Mm02_00321181 predicted 2534
6 SASI_Mm01_00126132 predicted 2242
7 SASI_Mm01_00126133 predicted 2356
8 SASI_Mm01_00126134 predicted 1500
9 SASI_Mm01_00126135 predicted 2159
10 SASI_Mm02_00321182 predicted 1182
11 SASI_Mm01_00126129 predicted 1746
12 SASI_Mm01_00126131 predicted 2054
13 SASI_Mm01_00126136 predicted 2447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173010 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345054 predicted 2242
2 SASI_Mm01_00039364 predicted 806
3 SASI_Mm01_00039365 predicted 1514
4 SASI_Mm01_00039367 predicted 1190
5 SASI_Mm02_00345055 predicted 2344
6 SASI_Mm01_00039369 predicted 2055
7 SASI_Mm01_00039370 predicted 2173
8 SASI_Mm01_00039371 predicted 1320
9 SASI_Mm01_00039372 predicted 1975
10 SASI_Mm02_00345056 predicted 998
11 SASI_Mm01_00039366 predicted 1567
12 SASI_Mm01_00039368 predicted 1870
13 SASI_Mm01_00039373 predicted 2256
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000462
UBE3A MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000462.2-419s21c1
Sequence:CCGGGTAGAGAAAGAGAGGATTATTCTCGAGAATAATCCTCTCTTTCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000462.2-3097s21c1
Sequence:CCGGGTCCCTGTATCTAACTCAAATCTCGAGATTTGAGTTAGATACAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000462.2-102s21c1
Sequence:CCGGACGCTACTACCACCAGTTAACCTCGAGGTTAACTGGTGGTAGTAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000462.2-1580s21c1
Sequence:CCGGTTAGACGTGACCATATCATAGCTCGAGCTATGATATGGTCACGTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000462.2-1851s21c1
Sequence:CCGGAGTACTGGGTCTGGCTATTTACTCGAGTAAATAGCCAGACCCAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000462.x-2512s1c1
Sequence:CCGGCCTACATCTCATACTTGCTTTCTCGAGAAAGCAAGTATGAGATGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000462.x-2549s1c1
Sequence:CCGGCGGAATACTCAAGCAAAGAAACTCGAGTTTCTTTGCTTGAGTATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000462.x-3051s1c1
Sequence:CCGGCCACCATTTGTAGACCACGTACTCGAGTACGTGGTCTACAAATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000462.x-1021s1c1
Sequence:CCGGGAGACATTTCAGCAACTTATTCTCGAGAATAAGTTGCTGAAATGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000462.x-685s1c1
Sequence:CCGGCCTGATGATGTGTCTGTGGATCTCGAGATCCACAGACACATCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000462
UBE3A MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000462.2-419s21c1
Sequence:CCGGGTAGAGAAAGAGAGGATTATTCTCGAGAATAATCCTCTCTTTCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000462.2-3097s21c1
Sequence:CCGGGTCCCTGTATCTAACTCAAATCTCGAGATTTGAGTTAGATACAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000462.2-102s21c1
Sequence:CCGGACGCTACTACCACCAGTTAACCTCGAGGTTAACTGGTGGTAGTAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000462.2-1580s21c1
Sequence:CCGGTTAGACGTGACCATATCATAGCTCGAGCTATGATATGGTCACGTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000462.2-1851s21c1
Sequence:CCGGAGTACTGGGTCTGGCTATTTACTCGAGTAAATAGCCAGACCCAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000462.x-2512s1c1
Sequence:CCGGCCTACATCTCATACTTGCTTTCTCGAGAAAGCAAGTATGAGATGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000462.x-2549s1c1
Sequence:CCGGCGGAATACTCAAGCAAAGAAACTCGAGTTTCTTTGCTTGAGTATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000462.x-3051s1c1
Sequence:CCGGCCACCATTTGTAGACCACGTACTCGAGTACGTGGTCTACAAATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000462.x-1021s1c1
Sequence:CCGGGAGACATTTCAGCAACTTATTCTCGAGAATAAGTTGCTGAAATGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000462.x-685s1c1
Sequence:CCGGCCTGATGATGTGTCTGTGGATCTCGAGATCCACAGACACATCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000462
UBE3A MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000462.2-419s21c1
Sequence:CCGGGTAGAGAAAGAGAGGATTATTCTCGAGAATAATCCTCTCTTTCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000462.2-3097s21c1
Sequence:CCGGGTCCCTGTATCTAACTCAAATCTCGAGATTTGAGTTAGATACAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000462.2-102s21c1
Sequence:CCGGACGCTACTACCACCAGTTAACCTCGAGGTTAACTGGTGGTAGTAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000462.2-1580s21c1
Sequence:CCGGTTAGACGTGACCATATCATAGCTCGAGCTATGATATGGTCACGTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000462.2-1851s21c1
Sequence:CCGGAGTACTGGGTCTGGCTATTTACTCGAGTAAATAGCCAGACCCAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000462.x-2512s1c1
Sequence:CCGGCCTACATCTCATACTTGCTTTCTCGAGAAAGCAAGTATGAGATGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000462.x-2549s1c1
Sequence:CCGGCGGAATACTCAAGCAAAGAAACTCGAGTTTCTTTGCTTGAGTATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000462.x-3051s1c1
Sequence:CCGGCCACCATTTGTAGACCACGTACTCGAGTACGTGGTCTACAAATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000462.x-1021s1c1
Sequence:CCGGGAGACATTTCAGCAACTTATTCTCGAGAATAAGTTGCTGAAATGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000462.x-685s1c1
Sequence:CCGGCCTGATGATGTGTCTGTGGATCTCGAGATCCACAGACACATCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011668
VALIDATED
UBE3A MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011668.1-1228s1c1
Sequence:CCGGCGGAGAATGATGGAAACATTTCTCGAGAAATGTTTCCATCATTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011668.1-2286s1c1
Sequence:CCGGCCCAATGATGTATGATCTAAACTCGAGTTTAGATCATACATCATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011668.1-1327s1c1
Sequence:CCGGGCTGCTTCAAACTGTTTGAAACTCGAGTTTCAAACAGTTTGAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011668.1-1833s1c1
Sequence:CCGGCCGGCTAGAGATGATTGCTATCTCGAGATAGCAATCATCTCTAGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011668.1-983s1c1
Sequence:CCGGCCTTCCTGAATGCACTTGTATCTCGAGATACAAGTGCATTCAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011668
VALIDATED
UBE3A MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011668.1-1228s1c1
Sequence:CCGGCGGAGAATGATGGAAACATTTCTCGAGAAATGTTTCCATCATTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011668.1-2286s1c1
Sequence:CCGGCCCAATGATGTATGATCTAAACTCGAGTTTAGATCATACATCATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011668.1-1327s1c1
Sequence:CCGGGCTGCTTCAAACTGTTTGAAACTCGAGTTTCAAACAGTTTGAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011668.1-1833s1c1
Sequence:CCGGCCGGCTAGAGATGATTGCTATCTCGAGATAGCAATCATCTCTAGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011668.1-983s1c1
Sequence:CCGGCCTTCCTGAATGCACTTGTATCTCGAGATACAAGTGCATTCAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011668
VALIDATED
UBE3A MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011668.1-1228s1c1
Sequence:CCGGCGGAGAATGATGGAAACATTTCTCGAGAAATGTTTCCATCATTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011668.1-2286s1c1
Sequence:CCGGCCCAATGATGTATGATCTAAACTCGAGTTTAGATCATACATCATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011668.1-1327s1c1
Sequence:CCGGGCTGCTTCAAACTGTTTGAAACTCGAGTTTCAAACAGTTTGAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011668.1-1833s1c1
Sequence:CCGGCCGGCTAGAGATGATTGCTATCTCGAGATAGCAATCATCTCTAGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011668.1-983s1c1
Sequence:CCGGCCTTCCTGAATGCACTTGTATCTCGAGATACAAGTGCATTCAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks