EMAIL THIS PAGE TO A FRIEND

UBE3B

ubiquitin protein ligase E3B

Synonyms: BPIDS
UniProtKB ID: Q7Z3V4, A5D8Z3, Q05BX9, Q659F7, Q7Z7Q1, Q9BXZ4
Gene ID:
Human(89910) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
Mouse(117146) ubiquitin protein ligase E3B
Rat(687633) ubiquitin protein ligase E3B
Zebrafish(556864) ubiquitin protein ligase E3B
dog(486311) ubiquitin protein ligase E3B
Horse(100059725) ubiquitin protein ligase E3B
domestic cat(101085926) ubiquitin protein ligase E3B
chicken(374194) ubiquitin protein ligase E3B
domestic guinea pig(100720918) ubiquitin protein ligase E3B
Domestic Rabbit(100338868) ubiquitin protein ligase E3B
naked mole-rat(101709240) ubiquitin protein ligase E3B
cow(512750) ubiquitin protein ligase E3B
sheep(101123152) ubiquitin protein ligase E3B
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102629 Anti-UBE3B antibody produced in rabbit affinity isolated antibody guinea pig, canine, horse, bovine, rabbit, rat, zebrafish, human, mouse,
western blot pricing
SAB4503523 Anti-UBE3B antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
HPA041012 Anti-UBE3B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130466 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130466 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130466 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_054093 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054093 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054093 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130466 Rosetta Predictions human pricing
NM_183414 Rosetta Predictions human pricing
NM_183415 Rosetta Predictions human pricing
XM_001077953 Rosetta Predictions rat pricing
XM_001077967 Rosetta Predictions rat pricing
NM_054093 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090706 predicted 1773
2 SASI_Hs02_00362756 predicted 3292
3 SASI_Hs01_00090707 predicted 1493
4 SASI_Hs02_00362757 predicted 3378
5 SASI_Hs02_00362758 predicted 3415
6 SASI_Hs01_00090709 predicted 1346
7 SASI_Hs02_00362759 predicted 3276
8 SASI_Hs01_00090711 predicted 2388
9 SASI_Hs02_00362760 predicted 2767
10 SASI_Hs02_00362761 predicted 2557
11 SASI_Hs01_00090708 predicted 3513
12 SASI_Hs01_00090710 predicted 1321
13 SASI_Hs01_00090712 predicted 879
14 SASI_Hs01_00090713 predicted 1717
15 SASI_Hs01_00090714 predicted 2174
16 SASI_Hs01_00090715 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177309 predicted 1773
2 SASI_Hs01_00177310 predicted 1498
3 SASI_Hs01_00177311 predicted 1281
4 SASI_Hs01_00177312 predicted 1731
5 SASI_Hs01_00177313 predicted 1351
6 SASI_Hs01_00177314 predicted 1317
7 SASI_Hs01_00177315 predicted 2395
8 SASI_Hs01_00177316 predicted 886
9 SASI_Hs01_00177317 predicted 1930
10 SASI_Hs01_00177318 predicted 1718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167888 predicted 1424
2 SASI_Hs02_00371311 predicted 2945
3 SASI_Hs01_00167889 predicted 1149
4 SASI_Hs02_00371312 predicted 3034
5 SASI_Hs02_00371313 predicted 3076
6 SASI_Hs01_00167891 predicted 997
7 SASI_Hs02_00371314 predicted 2931
8 SASI_Hs01_00167893 predicted 2044
9 SASI_Hs02_00371315 predicted 2421
10 SASI_Hs02_00371316 predicted 2215
11 SASI_Hs01_00167890 predicted 3169
12 SASI_Hs01_00167892 predicted 971
13 SASI_Hs01_00167894 predicted 536
14 SASI_Hs01_00167895 predicted 1366
15 SASI_Hs01_00167896 predicted 1823
16 SASI_Hs01_00167897 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359102 predicted 2238
2 SASI_Rn02_00359103 predicted 710
3 SASI_Rn02_00359104 predicted 2464
4 SASI_Rn02_00359105 predicted 2401
5 SASI_Rn02_00359106 predicted 883
6 SASI_Rn02_00359107 predicted 409
7 SASI_Rn02_00359108 predicted 1118
8 SASI_Rn02_00359109 predicted 1678
9 SASI_Rn02_00359110 predicted 1972
10 SASI_Rn02_00359111 predicted 2492
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077967 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359151 predicted 709
2 SASI_Rn02_00359152 predicted 2400
3 SASI_Rn02_00359153 predicted 882
4 SASI_Rn02_00359154 predicted 411
5 SASI_Rn02_00359155 predicted 1115
6 SASI_Rn02_00359156 predicted 3488
7 SASI_Rn02_00359157 predicted 1677
8 SASI_Rn02_00359158 predicted 2490
9 SASI_Rn02_00359159 predicted 3235
10 SASI_Rn02_00359160 predicted 2572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054093 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125858 predicted 1610
2 SASI_Mm01_00125859 predicted 2457
3 SASI_Mm01_00125860 predicted 1230
4 SASI_Mm02_00338037 predicted 987
5 SASI_Mm01_00125861 predicted 3671
6 SASI_Mm01_00125862 predicted 1060
7 SASI_Mm01_00125863 predicted 2178
8 SASI_Mm01_00125864 predicted 1589
9 SASI_Mm01_00125865 predicted 2198
10 SASI_Mm01_00125866 predicted 1675
11 SASI_Mm01_00125867 predicted 2556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130466
UBE3B MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130466.2-5320s1c1
Sequence:CCGGGCTCGGTTCCTTTGAAGATTTCTCGAGAAATCTTCAAAGGAACCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130466.2-2982s1c1
Sequence:CCGGCGTGCCATTTGCATCCTTCTTCTCGAGAAGAAGGATGCAAATGGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130466.2-1494s1c1
Sequence:CCGGCCGTGATGTATGTGAAAGTTTCTCGAGAAACTTTCACATACATCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130466.2-1875s1c1
Sequence:CCGGCCCAGTGAAGAGTCTCCTAAACTCGAGTTTAGGAGACTCTTCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130466.2-2280s1c1
Sequence:CCGGGCTGGTCACTATCTCCTCTTTCTCGAGAAAGAGGAGATAGTGACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130466.2-1494s21c1
Sequence:CCGGCCGTGATGTATGTGAAAGTTTCTCGAGAAACTTTCACATACATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130466.2-1875s21c1
Sequence:CCGGCCCAGTGAAGAGTCTCCTAAACTCGAGTTTAGGAGACTCTTCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130466.2-5320s21c1
Sequence:CCGGGCTCGGTTCCTTTGAAGATTTCTCGAGAAATCTTCAAAGGAACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130466.2-2280s21c1
Sequence:CCGGGCTGGTCACTATCTCCTCTTTCTCGAGAAAGAGGAGATAGTGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130466
UBE3B MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130466.2-5320s1c1
Sequence:CCGGGCTCGGTTCCTTTGAAGATTTCTCGAGAAATCTTCAAAGGAACCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130466.2-2982s1c1
Sequence:CCGGCGTGCCATTTGCATCCTTCTTCTCGAGAAGAAGGATGCAAATGGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130466.2-1494s1c1
Sequence:CCGGCCGTGATGTATGTGAAAGTTTCTCGAGAAACTTTCACATACATCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130466.2-1875s1c1
Sequence:CCGGCCCAGTGAAGAGTCTCCTAAACTCGAGTTTAGGAGACTCTTCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130466.2-2280s1c1
Sequence:CCGGGCTGGTCACTATCTCCTCTTTCTCGAGAAAGAGGAGATAGTGACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130466.2-1494s21c1
Sequence:CCGGCCGTGATGTATGTGAAAGTTTCTCGAGAAACTTTCACATACATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130466.2-1875s21c1
Sequence:CCGGCCCAGTGAAGAGTCTCCTAAACTCGAGTTTAGGAGACTCTTCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130466.2-5320s21c1
Sequence:CCGGGCTCGGTTCCTTTGAAGATTTCTCGAGAAATCTTCAAAGGAACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130466.2-2280s21c1
Sequence:CCGGGCTGGTCACTATCTCCTCTTTCTCGAGAAAGAGGAGATAGTGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130466
UBE3B MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130466.2-5320s1c1
Sequence:CCGGGCTCGGTTCCTTTGAAGATTTCTCGAGAAATCTTCAAAGGAACCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130466.2-2982s1c1
Sequence:CCGGCGTGCCATTTGCATCCTTCTTCTCGAGAAGAAGGATGCAAATGGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130466.2-1494s1c1
Sequence:CCGGCCGTGATGTATGTGAAAGTTTCTCGAGAAACTTTCACATACATCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130466.2-1875s1c1
Sequence:CCGGCCCAGTGAAGAGTCTCCTAAACTCGAGTTTAGGAGACTCTTCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130466.2-2280s1c1
Sequence:CCGGGCTGGTCACTATCTCCTCTTTCTCGAGAAAGAGGAGATAGTGACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130466.2-1494s21c1
Sequence:CCGGCCGTGATGTATGTGAAAGTTTCTCGAGAAACTTTCACATACATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130466.2-1875s21c1
Sequence:CCGGCCCAGTGAAGAGTCTCCTAAACTCGAGTTTAGGAGACTCTTCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130466.2-5320s21c1
Sequence:CCGGGCTCGGTTCCTTTGAAGATTTCTCGAGAAATCTTCAAAGGAACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130466.2-2280s21c1
Sequence:CCGGGCTGGTCACTATCTCCTCTTTCTCGAGAAAGAGGAGATAGTGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054093
VALIDATED
UBE3B MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_054093.1-1782s1c1
Sequence:CCGGCGTCCTACATTCACGAGAATTCTCGAGAATTCTCGTGAATGTAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_054093.1-601s1c1
Sequence:CCGGCGGCCTCAATGATTCCATGTACTCGAGTACATGGAATCATTGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_054093.1-1117s1c1
Sequence:CCGGCCTCGATGACATTGAAGTTTACTCGAGTAAACTTCAATGTCATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054093.1-508s1c1
Sequence:CCGGGCTGTGCTACTGTCAGAAGTACTCGAGTACTTCTGACAGTAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_054093.1-2099s1c1
Sequence:CCGGCCGGTTACAGATGAGAACAAACTCGAGTTTGTTCTCATCTGTAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054093
VALIDATED
UBE3B MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_054093.1-1782s1c1
Sequence:CCGGCGTCCTACATTCACGAGAATTCTCGAGAATTCTCGTGAATGTAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_054093.1-601s1c1
Sequence:CCGGCGGCCTCAATGATTCCATGTACTCGAGTACATGGAATCATTGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_054093.1-1117s1c1
Sequence:CCGGCCTCGATGACATTGAAGTTTACTCGAGTAAACTTCAATGTCATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054093.1-508s1c1
Sequence:CCGGGCTGTGCTACTGTCAGAAGTACTCGAGTACTTCTGACAGTAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_054093.1-2099s1c1
Sequence:CCGGCCGGTTACAGATGAGAACAAACTCGAGTTTGTTCTCATCTGTAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054093
VALIDATED
UBE3B MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_054093.1-1782s1c1
Sequence:CCGGCGTCCTACATTCACGAGAATTCTCGAGAATTCTCGTGAATGTAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_054093.1-601s1c1
Sequence:CCGGCGGCCTCAATGATTCCATGTACTCGAGTACATGGAATCATTGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_054093.1-1117s1c1
Sequence:CCGGCCTCGATGACATTGAAGTTTACTCGAGTAAACTTCAATGTCATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054093.1-508s1c1
Sequence:CCGGGCTGTGCTACTGTCAGAAGTACTCGAGTACTTCTGACAGTAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_054093.1-2099s1c1
Sequence:CCGGCCGGTTACAGATGAGAACAAACTCGAGTTTGTTCTCATCTGTAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks