EMAIL THIS PAGE TO A FRIEND

UBE3C

ubiquitin protein ligase E3C

Synonyms: HECTH2
UniProtKB ID: Q15386, A4D235, A6NCP3, Q8TC15, Q96CR4, Q9UDU3
Gene ID:
Mouse(100763) ubiquitin protein ligase E3C
Rat(362294) ubiquitin protein ligase E3C
cow(508513) ubiquitin protein ligase E3C
sheep(101107439) ubiquitin protein ligase E3C
naked mole-rat(101717256) ubiquitin protein ligase E3C
Domestic Rabbit(100352014) ubiquitin protein ligase E3C
domestic guinea pig(100723450) ubiquitin protein ligase E3C
Zebrafish(393445) ubiquitin protein ligase E3C
domestic cat(101085362) ubiquitin protein ligase E3C
dog(482822) ubiquitin protein ligase E3C
chicken(420447) ubiquitin protein ligase E3C
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014671 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014671 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014671 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133907 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133907 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133907 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014671 Rosetta Predictions human pricing
XM_001055148 Rosetta Predictions rat pricing
XM_347039 Rosetta Predictions rat pricing
NM_133907 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194874 predicted 1880
2 SASI_Hs01_00194875 predicted 2599
3 SASI_Hs01_00194876 predicted 1928
4 SASI_Hs01_00194877 predicted 793
5 SASI_Hs01_00194878 predicted 3336
6 SASI_Hs01_00194879 predicted 1654
7 SASI_Hs01_00194880 predicted 1791
8 SASI_Hs01_00194881 predicted 927
9 SASI_Hs01_00194882 predicted 1833
10 SASI_Hs02_00346023 predicted 2898
11 SASI_Hs01_00194873 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278606 predicted 590
2 SASI_Rn02_00278607 predicted 3099
3 SASI_Rn02_00278608 predicted 670
4 SASI_Rn02_00278609 predicted 1241
5 SASI_Rn02_00278610 predicted 747
6 SASI_Rn02_00278611 predicted 1745
7 SASI_Rn02_00278612 predicted 1687
8 SASI_Rn02_00278613 predicted 3136
9 SASI_Rn02_00278614 predicted 2439
10 SASI_Rn02_00278615 predicted 1890
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_347039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399494 predicted 585
2 SASI_Rn02_00399495 predicted 3091
3 SASI_Rn02_00399496 predicted 674
4 SASI_Rn02_00399497 predicted 1240
5 SASI_Rn02_00399498 predicted 751
6 SASI_Rn02_00399499 predicted 1746
7 SASI_Rn02_00399500 predicted 1685
8 SASI_Rn02_00399501 predicted 3140
9 SASI_Rn02_00399502 predicted 2444
10 SASI_Rn02_00399503 predicted 1889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050911 predicted 460
2 SASI_Mm01_00050912 predicted 608
3 SASI_Mm01_00050914 predicted 3180
4 SASI_Mm01_00050915 predicted 3099
5 SASI_Mm01_00050916 predicted 902
6 SASI_Mm01_00050919 predicted 1242
7 SASI_Mm01_00050920 predicted 1748
8 SASI_Mm02_00338964 predicted 1670
9 SASI_Mm02_00338965 predicted 3137
10 SASI_Mm02_00338966 predicted 915
11 SASI_Mm01_00050913 predicted 1547
12 SASI_Mm01_00050917 predicted 940
13 SASI_Mm01_00050918 predicted 1007
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014671
VALIDATED
UBE3C MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014671.2-1639s21c1
Sequence:CCGGGTCAGGCTTCTCTACAGTTTACTCGAGTAAACTGTAGAGAAGCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014671.2-2434s21c1
Sequence:CCGGGCAGATAAGCAAGAAGTTCAACTCGAGTTGAACTTCTTGCTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014671.2-4240s21c1
Sequence:CCGGGTCCTATTTCTATCTCCACTTCTCGAGAAGTGGAGATAGAAATAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014671.x-2746s1c1
Sequence:CCGGGCCAGACATTACTACTTCCTACTCGAGTAGGAAGTAGTAATGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014671.x-2425s1c1
Sequence:CCGGGCAGATAAGCAAGAAGTTCAACTCGAGTTGAACTTCTTGCTTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014671.x-459s1c1
Sequence:CCGGCCAGTCATTTATTCGAGGCTACTCGAGTAGCCTCGAATAAATGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014671.x-4231s1c1
Sequence:CCGGGTCCTATTTCTATCTCCACTTCTCGAGAAGTGGAGATAGAAATAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014671.x-1630s1c1
Sequence:CCGGGTCAGGCTTCTCTACAGTTTACTCGAGTAAACTGTAGAGAAGCCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014671
VALIDATED
UBE3C MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014671.2-1639s21c1
Sequence:CCGGGTCAGGCTTCTCTACAGTTTACTCGAGTAAACTGTAGAGAAGCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014671.2-2434s21c1
Sequence:CCGGGCAGATAAGCAAGAAGTTCAACTCGAGTTGAACTTCTTGCTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014671.2-4240s21c1
Sequence:CCGGGTCCTATTTCTATCTCCACTTCTCGAGAAGTGGAGATAGAAATAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014671.x-2746s1c1
Sequence:CCGGGCCAGACATTACTACTTCCTACTCGAGTAGGAAGTAGTAATGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014671.x-2425s1c1
Sequence:CCGGGCAGATAAGCAAGAAGTTCAACTCGAGTTGAACTTCTTGCTTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014671.x-459s1c1
Sequence:CCGGCCAGTCATTTATTCGAGGCTACTCGAGTAGCCTCGAATAAATGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014671.x-4231s1c1
Sequence:CCGGGTCCTATTTCTATCTCCACTTCTCGAGAAGTGGAGATAGAAATAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014671.x-1630s1c1
Sequence:CCGGGTCAGGCTTCTCTACAGTTTACTCGAGTAAACTGTAGAGAAGCCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014671
VALIDATED
UBE3C MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014671.2-1639s21c1
Sequence:CCGGGTCAGGCTTCTCTACAGTTTACTCGAGTAAACTGTAGAGAAGCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014671.2-2434s21c1
Sequence:CCGGGCAGATAAGCAAGAAGTTCAACTCGAGTTGAACTTCTTGCTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014671.2-4240s21c1
Sequence:CCGGGTCCTATTTCTATCTCCACTTCTCGAGAAGTGGAGATAGAAATAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014671.x-2746s1c1
Sequence:CCGGGCCAGACATTACTACTTCCTACTCGAGTAGGAAGTAGTAATGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014671.x-2425s1c1
Sequence:CCGGGCAGATAAGCAAGAAGTTCAACTCGAGTTGAACTTCTTGCTTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014671.x-459s1c1
Sequence:CCGGCCAGTCATTTATTCGAGGCTACTCGAGTAGCCTCGAATAAATGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014671.x-4231s1c1
Sequence:CCGGGTCCTATTTCTATCTCCACTTCTCGAGAAGTGGAGATAGAAATAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014671.x-1630s1c1
Sequence:CCGGGTCAGGCTTCTCTACAGTTTACTCGAGTAAACTGTAGAGAAGCCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133907
VALIDATED
UBE3C MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133907.3-2395s21c1
Sequence:CCGGGCTGATAAGCAAGAAGTTCAACTCGAGTTGAACTTCTTGCTTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133907.3-2716s21c1
Sequence:CCGGGCAAGGCATTACTACTTCCTACTCGAGTAGGAAGTAGTAATGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133907.3-769s21c1
Sequence:CCGGGCACTTCCAATGCGAATGCTTCTCGAGAAGCATTCGCATTGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133907.3-647s21c1
Sequence:CCGGGCTCTCTGTTTGTCAAGCAATCTCGAGATTGCTTGACAAACAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133907.3-3235s21c1
Sequence:CCGGGCCGATCATCCTGTCATTAAACTCGAGTTTAATGACAGGATGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133907.1-648s1c1
Sequence:CCGGGCTCTCTGTTTGTCAAGCAATCTCGAGATTGCTTGACAAACAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133907.1-770s1c1
Sequence:CCGGGCACTTCCAATGCGAATGCTTCTCGAGAAGCATTCGCATTGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133907.1-2717s1c1
Sequence:CCGGGCAAGGCATTACTACTTCCTACTCGAGTAGGAAGTAGTAATGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133907.1-3236s1c1
Sequence:CCGGGCCGATCATCCTGTCATTAAACTCGAGTTTAATGACAGGATGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133907.1-2396s1c1
Sequence:CCGGGCTGATAAGCAAGAAGTTCAACTCGAGTTGAACTTCTTGCTTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133907
VALIDATED
UBE3C MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133907.3-2395s21c1
Sequence:CCGGGCTGATAAGCAAGAAGTTCAACTCGAGTTGAACTTCTTGCTTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133907.3-2716s21c1
Sequence:CCGGGCAAGGCATTACTACTTCCTACTCGAGTAGGAAGTAGTAATGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133907.3-769s21c1
Sequence:CCGGGCACTTCCAATGCGAATGCTTCTCGAGAAGCATTCGCATTGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133907.3-647s21c1
Sequence:CCGGGCTCTCTGTTTGTCAAGCAATCTCGAGATTGCTTGACAAACAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133907.3-3235s21c1
Sequence:CCGGGCCGATCATCCTGTCATTAAACTCGAGTTTAATGACAGGATGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133907.1-648s1c1
Sequence:CCGGGCTCTCTGTTTGTCAAGCAATCTCGAGATTGCTTGACAAACAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133907.1-770s1c1
Sequence:CCGGGCACTTCCAATGCGAATGCTTCTCGAGAAGCATTCGCATTGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133907.1-2717s1c1
Sequence:CCGGGCAAGGCATTACTACTTCCTACTCGAGTAGGAAGTAGTAATGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133907.1-3236s1c1
Sequence:CCGGGCCGATCATCCTGTCATTAAACTCGAGTTTAATGACAGGATGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133907.1-2396s1c1
Sequence:CCGGGCTGATAAGCAAGAAGTTCAACTCGAGTTGAACTTCTTGCTTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133907
VALIDATED
UBE3C MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133907.3-2395s21c1
Sequence:CCGGGCTGATAAGCAAGAAGTTCAACTCGAGTTGAACTTCTTGCTTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133907.3-2716s21c1
Sequence:CCGGGCAAGGCATTACTACTTCCTACTCGAGTAGGAAGTAGTAATGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133907.3-769s21c1
Sequence:CCGGGCACTTCCAATGCGAATGCTTCTCGAGAAGCATTCGCATTGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133907.3-647s21c1
Sequence:CCGGGCTCTCTGTTTGTCAAGCAATCTCGAGATTGCTTGACAAACAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133907.3-3235s21c1
Sequence:CCGGGCCGATCATCCTGTCATTAAACTCGAGTTTAATGACAGGATGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133907.1-648s1c1
Sequence:CCGGGCTCTCTGTTTGTCAAGCAATCTCGAGATTGCTTGACAAACAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133907.1-770s1c1
Sequence:CCGGGCACTTCCAATGCGAATGCTTCTCGAGAAGCATTCGCATTGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133907.1-2717s1c1
Sequence:CCGGGCAAGGCATTACTACTTCCTACTCGAGTAGGAAGTAGTAATGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133907.1-3236s1c1
Sequence:CCGGGCCGATCATCCTGTCATTAAACTCGAGTTTAATGACAGGATGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133907.1-2396s1c1
Sequence:CCGGGCTGATAAGCAAGAAGTTCAACTCGAGTTGAACTTCTTGCTTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks