EMAIL THIS PAGE TO A FRIEND

UBE3D

ubiquitin protein ligase E3D

Synonyms: C6orf157 H10BH UBE2CBP YJR141W
UniProtKB ID: Q7Z6J8, B4DP63, Q5T4W2, Q6IPR4, Q75UG0, Q9NT42
Gene ID:
Rat(315863) ubiquitin protein ligase E3D
Zebrafish(553294) ubiquitin protein ligase E3D
domestic cat(101086229) ubiquitin protein ligase E3D
domestic guinea pig(100730012) ubiquitin protein ligase E3D
naked mole-rat(101719796) ubiquitin protein ligase E3D
cow(515386) ubiquitin-conjugating enzyme E2C binding protein
sheep(101114449) ubiquitin protein ligase E3D
162 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198920 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025021 MISSION® esiRNA esiRNA human UBE2CBP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198920 Rosetta Predictions human pricing
NM_001039610 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184702 predicted 974
2 SASI_Hs01_00184703 predicted 963
3 SASI_Hs01_00184704 predicted 790
4 SASI_Hs02_00372409 predicted 623
5 SASI_Hs02_00372410 predicted 976
6 SASI_Hs01_00184706 predicted 800
7 SASI_Hs01_00184707 predicted 663
8 SASI_Hs01_00184708 predicted 435
9 SASI_Hs01_00184709 predicted 913
10 SASI_Hs01_00184710 predicted 838
11 SASI_Hs01_00184705 predicted 693
12 SASI_Hs01_00184711 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035765 predicted 788
2 SASI_Rn01_00035766 predicted 937
3 SASI_Rn01_00035767 predicted 777
4 SASI_Rn02_00204863 predicted 847
5 SASI_Rn02_00204864 predicted 1200
6 SASI_Rn01_00035770 predicted 1085
7 SASI_Rn01_00035772 predicted 411
8 SASI_Rn01_00035773 predicted 960
9 SASI_Rn01_00035774 predicted 375
10 SASI_Rn02_00204865 predicted 226
11 SASI_Rn01_00035768 predicted 1133
12 SASI_Rn01_00035769 predicted 1208
13 SASI_Rn01_00035771 predicted 1145
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198920
VALIDATED
UBE3D MISSION shRNA Bacterial Glycerol Stock
ubiquitin protein ligase E3D
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198920.1-318s1c1
Sequence:CCGGGCTACAGTTTGTTGTTGGAGACTCGAGTCTCCAACAACAAACTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198920.1-1211s1c1
Sequence:CCGGGTAATGCCAATCTGCCTTCATCTCGAGATGAAGGCAGATTGGCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198920.1-1665s1c1
Sequence:CCGGCTGCTGTAAATCCTAGGAAATCTCGAGATTTCCTAGGATTTACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_198920.1-319s1c1
Sequence:CCGGCTACAGTTTGTTGTTGGAGATCTCGAGATCTCCAACAACAAACTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_198920.1-971s1c1
Sequence:CCGGCAGACAGTTTGGTGATTGAATCTCGAGATTCAATCACCAAACTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198920.1-1369s1c1
Sequence:CCGGCAAAGACAAGAACCAGAGCTACTCGAGTAGCTCTGGTTCTTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198920.1-1513s1c1
Sequence:CCGGGCAAGTGTAGAAGTTACATCTCTCGAGAGATGTAACTTCTACACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198920.1-198s21c1
Sequence:CCGGAGGAGGTATGCCCATGAATATCTCGAGATATTCATGGGCATACCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198920.1-732s21c1
Sequence:CCGGTTGTAAGCGTTGCAAGGTAATCTCGAGATTACCTTGCAACGCTTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198920.1-1451s21c1
Sequence:CCGGAGAGTTAACTTTAGATCTTTGCTCGAGCAAAGATCTAAAGTTAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198920
VALIDATED
UBE3D MISSION shRNA shRNA Plasmid DNA
ubiquitin protein ligase E3D
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198920.1-318s1c1
Sequence:CCGGGCTACAGTTTGTTGTTGGAGACTCGAGTCTCCAACAACAAACTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198920.1-1211s1c1
Sequence:CCGGGTAATGCCAATCTGCCTTCATCTCGAGATGAAGGCAGATTGGCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198920.1-1665s1c1
Sequence:CCGGCTGCTGTAAATCCTAGGAAATCTCGAGATTTCCTAGGATTTACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_198920.1-319s1c1
Sequence:CCGGCTACAGTTTGTTGTTGGAGATCTCGAGATCTCCAACAACAAACTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_198920.1-971s1c1
Sequence:CCGGCAGACAGTTTGGTGATTGAATCTCGAGATTCAATCACCAAACTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198920.1-1369s1c1
Sequence:CCGGCAAAGACAAGAACCAGAGCTACTCGAGTAGCTCTGGTTCTTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198920.1-1513s1c1
Sequence:CCGGGCAAGTGTAGAAGTTACATCTCTCGAGAGATGTAACTTCTACACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198920.1-198s21c1
Sequence:CCGGAGGAGGTATGCCCATGAATATCTCGAGATATTCATGGGCATACCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198920.1-732s21c1
Sequence:CCGGTTGTAAGCGTTGCAAGGTAATCTCGAGATTACCTTGCAACGCTTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198920.1-1451s21c1
Sequence:CCGGAGAGTTAACTTTAGATCTTTGCTCGAGCAAAGATCTAAAGTTAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198920
VALIDATED
UBE3D MISSION shRNA Lentiviral Transduction Particles
ubiquitin protein ligase E3D
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198920.1-318s1c1
Sequence:CCGGGCTACAGTTTGTTGTTGGAGACTCGAGTCTCCAACAACAAACTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198920.1-1211s1c1
Sequence:CCGGGTAATGCCAATCTGCCTTCATCTCGAGATGAAGGCAGATTGGCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198920.1-1665s1c1
Sequence:CCGGCTGCTGTAAATCCTAGGAAATCTCGAGATTTCCTAGGATTTACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_198920.1-319s1c1
Sequence:CCGGCTACAGTTTGTTGTTGGAGATCTCGAGATCTCCAACAACAAACTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_198920.1-971s1c1
Sequence:CCGGCAGACAGTTTGGTGATTGAATCTCGAGATTCAATCACCAAACTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198920.1-1369s1c1
Sequence:CCGGCAAAGACAAGAACCAGAGCTACTCGAGTAGCTCTGGTTCTTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198920.1-1513s1c1
Sequence:CCGGGCAAGTGTAGAAGTTACATCTCTCGAGAGATGTAACTTCTACACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198920.1-198s21c1
Sequence:CCGGAGGAGGTATGCCCATGAATATCTCGAGATATTCATGGGCATACCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198920.1-732s21c1
Sequence:CCGGTTGTAAGCGTTGCAAGGTAATCTCGAGATTACCTTGCAACGCTTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198920.1-1451s21c1
Sequence:CCGGAGAGTTAACTTTAGATCTTTGCTCGAGCAAAGATCTAAAGTTAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks