EMAIL THIS PAGE TO A FRIEND

UBE4A

ubiquitination factor E4A

Synonyms: E4 UBOX2 UFD2
UniProtKB ID: Q14139, B0YJB6, Q2M1H0, Q6P5T4, Q7Z639
Gene ID:
Human(9354) Summary: This gene encodes a member of the U-box ubiquitin ligase family. The encoded protein is involved in multiubiquitin chain assembly and plays a critical role in chromosome condensation and separation through the polyubiquitination of securin. Autoantibodies against the encoded protein may be markers for scleroderma and Crohn's disease. A pseudogene of this gene is located on the long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Mouse(140630) ubiquitination factor E4A, UFD2 homolog (S. cerevisiae)
Rat(315608) ubiquitination factor E4A
cow(517544) ubiquitination factor E4A
sheep(101123231) ubiquitination factor E4A
naked mole-rat(101711837) ubiquitination factor E4A
domestic guinea pig(100726213) ubiquitination factor E4A
Zebrafish(557121) ubiquitination factor E4A (UFD2 homolog, yeast)
Horse(100062986) ubiquitination factor E4A
domestic cat(101089796) ubiquitination factor E4A
dog(479418) ubiquitination factor E4A
chicken(419758) ubiquitination factor E4A
128 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004788 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004788 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004788 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145400 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145400 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145400 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004788 Rosetta Predictions human pricing
NM_207610 Rosetta Predictions rat pricing
NM_145400 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004788 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075940 predicted 3019
2 SASI_Hs01_00075941 predicted 2884
3 SASI_Hs01_00075942 predicted 2007
4 SASI_Hs02_00338307 predicted 1801
5 SASI_Hs01_00075943 predicted 574
6 SASI_Hs01_00075945 predicted 3132
7 SASI_Hs02_00338308 predicted 2096
8 SASI_Hs01_00075946 predicted 1833
9 SASI_Hs01_00075947 predicted 713
10 SASI_Hs01_00075948 predicted 1965
11 SASI_Hs01_00075939 predicted 706
12 SASI_Hs01_00075944 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097338 predicted 3009
2 SASI_Rn01_00097339 predicted 2433
3 SASI_Rn01_00097342 predicted 2007
4 SASI_Rn01_00097343 predicted 2481
5 SASI_Rn02_00270438 predicted 897
6 SASI_Rn01_00097344 predicted 1392
7 SASI_Rn01_00097345 predicted 2874
8 SASI_Rn01_00097346 predicted 1576
9 SASI_Rn01_00097347 predicted 1015
10 SASI_Rn02_00270439 predicted 790
11 SASI_Rn01_00097340 predicted 935
12 SASI_Rn01_00097341 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340730 predicted 2934
2 SASI_Mm01_00199036 predicted 2110
3 SASI_Mm01_00199037 predicted 2130
4 SASI_Mm01_00199038 predicted 1504
5 SASI_Mm01_00199039 predicted 2866
6 SASI_Mm02_00340731 predicted 1367
7 SASI_Mm02_00340732 predicted 3082
8 SASI_Mm01_00199041 predicted 1686
9 SASI_Mm02_00340733 predicted 2941
10 SASI_Mm02_00340734 predicted 3117
11 SASI_Mm01_00199033 predicted 3148
12 SASI_Mm01_00199034 predicted 2683
13 SASI_Mm01_00199035 predicted 1268
14 SASI_Mm01_00199040 predicted 1934
15 SASI_Mm01_00199042 predicted 2562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004788
VALIDATED
UBE4A MISSION shRNA Bacterial Glycerol Stock
ubiquitination factor E4A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004788.2-547s21c1
Sequence:CCGGGCTCGCTTATTACTTCAAGATCTCGAGATCTTGAAGTAATAAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004788.2-3273s21c1
Sequence:CCGGCCGGCCAAACACAGAACTAAACTCGAGTTTAGTTCTGTGTTTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004788.2-3688s21c1
Sequence:CCGGCCCTGCTATTTCTCTTCCAATCTCGAGATTGGAAGAGAAATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004788.2-1137s21c1
Sequence:CCGGGCTGGGAGTAATTCTGAGTATCTCGAGATACTCAGAATTACTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004788.2-3688s1c1
Sequence:CCGGCCCTGCTATTTCTCTTCCAATCTCGAGATTGGAAGAGAAATAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004788.2-547s1c1
Sequence:CCGGGCTCGCTTATTACTTCAAGATCTCGAGATCTTGAAGTAATAAGCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004788.2-2775s1c1
Sequence:CCGGGCGCATCATCTCCATGTTGAACTCGAGTTCAACATGGAGATGATGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004788.2-1137s1c1
Sequence:CCGGGCTGGGAGTAATTCTGAGTATCTCGAGATACTCAGAATTACTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004788.2-3273s1c1
Sequence:CCGGCCGGCCAAACACAGAACTAAACTCGAGTTTAGTTCTGTGTTTGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004788
VALIDATED
UBE4A MISSION shRNA shRNA Plasmid DNA
ubiquitination factor E4A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004788.2-547s21c1
Sequence:CCGGGCTCGCTTATTACTTCAAGATCTCGAGATCTTGAAGTAATAAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004788.2-3273s21c1
Sequence:CCGGCCGGCCAAACACAGAACTAAACTCGAGTTTAGTTCTGTGTTTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004788.2-3688s21c1
Sequence:CCGGCCCTGCTATTTCTCTTCCAATCTCGAGATTGGAAGAGAAATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004788.2-1137s21c1
Sequence:CCGGGCTGGGAGTAATTCTGAGTATCTCGAGATACTCAGAATTACTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004788.2-3688s1c1
Sequence:CCGGCCCTGCTATTTCTCTTCCAATCTCGAGATTGGAAGAGAAATAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004788.2-547s1c1
Sequence:CCGGGCTCGCTTATTACTTCAAGATCTCGAGATCTTGAAGTAATAAGCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004788.2-2775s1c1
Sequence:CCGGGCGCATCATCTCCATGTTGAACTCGAGTTCAACATGGAGATGATGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004788.2-1137s1c1
Sequence:CCGGGCTGGGAGTAATTCTGAGTATCTCGAGATACTCAGAATTACTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004788.2-3273s1c1
Sequence:CCGGCCGGCCAAACACAGAACTAAACTCGAGTTTAGTTCTGTGTTTGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004788
VALIDATED
UBE4A MISSION shRNA Lentiviral Transduction Particles
ubiquitination factor E4A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004788.2-547s21c1
Sequence:CCGGGCTCGCTTATTACTTCAAGATCTCGAGATCTTGAAGTAATAAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004788.2-3273s21c1
Sequence:CCGGCCGGCCAAACACAGAACTAAACTCGAGTTTAGTTCTGTGTTTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004788.2-3688s21c1
Sequence:CCGGCCCTGCTATTTCTCTTCCAATCTCGAGATTGGAAGAGAAATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004788.2-1137s21c1
Sequence:CCGGGCTGGGAGTAATTCTGAGTATCTCGAGATACTCAGAATTACTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004788.2-3688s1c1
Sequence:CCGGCCCTGCTATTTCTCTTCCAATCTCGAGATTGGAAGAGAAATAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004788.2-547s1c1
Sequence:CCGGGCTCGCTTATTACTTCAAGATCTCGAGATCTTGAAGTAATAAGCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004788.2-2775s1c1
Sequence:CCGGGCGCATCATCTCCATGTTGAACTCGAGTTCAACATGGAGATGATGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004788.2-1137s1c1
Sequence:CCGGGCTGGGAGTAATTCTGAGTATCTCGAGATACTCAGAATTACTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004788.2-3273s1c1
Sequence:CCGGCCGGCCAAACACAGAACTAAACTCGAGTTTAGTTCTGTGTTTGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145400
VALIDATED
UBE4A MISSION shRNA Bacterial Glycerol Stock
ubiquitination factor E4A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145400.2-3205s1c1
Sequence:CCGGTGATAGCAGAATGACTGGTTACTCGAGTAACCAGTCATTCTGCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145400.2-1654s1c1
Sequence:CCGGGCCCGAAATCTTCTTCCAAATCTCGAGATTTGGAAGAAGATTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145400.2-809s1c1
Sequence:CCGGGCTCGATTATTGCTTCAAGATCTCGAGATCTTGAAGCAATAATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145400.2-2627s1c1
Sequence:CCGGCGTCCTATGTATCCCATCCTACTCGAGTAGGATGGGATACATAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145400.2-1390s1c1
Sequence:CCGGCCTGAATATCTCGTGCTTGTTCTCGAGAACAAGCACGAGATATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145400
VALIDATED
UBE4A MISSION shRNA shRNA Plasmid DNA
ubiquitination factor E4A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145400.2-3205s1c1
Sequence:CCGGTGATAGCAGAATGACTGGTTACTCGAGTAACCAGTCATTCTGCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145400.2-1654s1c1
Sequence:CCGGGCCCGAAATCTTCTTCCAAATCTCGAGATTTGGAAGAAGATTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145400.2-809s1c1
Sequence:CCGGGCTCGATTATTGCTTCAAGATCTCGAGATCTTGAAGCAATAATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145400.2-2627s1c1
Sequence:CCGGCGTCCTATGTATCCCATCCTACTCGAGTAGGATGGGATACATAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145400.2-1390s1c1
Sequence:CCGGCCTGAATATCTCGTGCTTGTTCTCGAGAACAAGCACGAGATATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145400
VALIDATED
UBE4A MISSION shRNA Lentiviral Transduction Particles
ubiquitination factor E4A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145400.2-3205s1c1
Sequence:CCGGTGATAGCAGAATGACTGGTTACTCGAGTAACCAGTCATTCTGCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145400.2-1654s1c1
Sequence:CCGGGCCCGAAATCTTCTTCCAAATCTCGAGATTTGGAAGAAGATTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145400.2-809s1c1
Sequence:CCGGGCTCGATTATTGCTTCAAGATCTCGAGATCTTGAAGCAATAATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145400.2-2627s1c1
Sequence:CCGGCGTCCTATGTATCCCATCCTACTCGAGTAGGATGGGATACATAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145400.2-1390s1c1
Sequence:CCGGCCTGAATATCTCGTGCTTGTTCTCGAGAACAAGCACGAGATATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks