EMAIL THIS PAGE TO A FRIEND

UBE4B

ubiquitination factor E4B

Synonyms: E4 HDNB1 UBOX3 UFD2 UFD2A
Gene ID:
Human(10277) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes an additional conjugation factor, E4, which is involved in multiubiquitin chain assembly. This gene is also the strongest candidate in the neuroblastoma tumor suppressor genes. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(63958) ubiquitination factor E4B, UFD2 homolog (S. cerevisiae)
Rat(298652) ubiquitination factor E4B
Zebrafish(170784) ubiquitination factor E4B, UFD2 homolog (S. cerevisiae)
chicken(419448) ubiquitination factor E4B
domestic cat(101095271) ubiquitination factor E4B
Horse(100057243) ubiquitination factor E4B
dog(479603) ubiquitination factor E4B
domestic guinea pig(100727679) ubiquitination factor E4B
naked mole-rat(101708165) ubiquitination factor E4B
Domestic Rabbit(100356207) ubiquitination factor E4B
cow(520833) ubiquitination factor E4B
sheep(101113088) ubiquitination factor E4B
134 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022022 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022022 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022022 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006048 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006048 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006048 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105562 Rosetta Predictions human pricing
NM_006048 Rosetta Predictions human pricing
XM_001075491 Rosetta Predictions rat pricing
XM_233679 Rosetta Predictions rat pricing
NM_022022 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324421 predicted 4171
2 SASI_Hs02_00324422 predicted 3292
3 SASI_Hs02_00324423 predicted 4154
4 SASI_Hs02_00324424 predicted 1164
5 SASI_Hs02_00324425 predicted 974
6 SASI_Hs02_00324426 predicted 3014
7 SASI_Hs02_00324427 predicted 2906
8 SASI_Hs02_00324428 predicted 2515
9 SASI_Hs02_00324429 predicted 2922
10 SASI_Hs02_00324430 predicted 2885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054553 predicted 3790
2 SASI_Hs01_00054554 predicted 2906
3 SASI_Hs01_00054556 predicted 3760
4 SASI_Hs01_00054557 predicted 1167
5 SASI_Hs01_00054558 predicted 980
6 SASI_Hs01_00054559 predicted 2633
7 SASI_Hs01_00054560 predicted 2527
8 SASI_Hs02_00340802 predicted 2131
9 SASI_Hs01_00054561 predicted 3843
10 SASI_Hs02_00340803 predicted 2539
11 SASI_Hs01_00054552 predicted 3729
12 SASI_Hs01_00054555 predicted 3374
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075491 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349944 predicted 2121
2 SASI_Rn02_00349945 predicted 1324
3 SASI_Rn02_00349946 predicted 1225
4 SASI_Rn02_00349947 predicted 3136
5 SASI_Rn02_00349948 predicted 3208
6 SASI_Rn02_00349949 predicted 1502
7 SASI_Rn02_00349950 predicted 2277
8 SASI_Rn02_00349951 predicted 3346
9 SASI_Rn02_00349952 predicted 2783
10 SASI_Rn02_00349953 predicted 1662
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233679 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126623 predicted 2876
2 SASI_Rn02_00387967 predicted 2497
3 SASI_Rn01_00126624 predicted 1992
4 SASI_Rn01_00126625 predicted 3889
5 SASI_Rn02_00387968 predicted 3967
6 SASI_Rn01_00126629 predicted 2262
7 SASI_Rn01_00126630 predicted 3026
8 SASI_Rn01_00126631 predicted 4099
9 SASI_Rn01_00126632 predicted 3536
10 SASI_Rn02_00387969 predicted 2419
11 SASI_Rn01_00126626 predicted 2054
12 SASI_Rn01_00126627 predicted 3407
13 SASI_Rn01_00126628 predicted 3915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022022 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178725 predicted 2493
2 SASI_Mm01_00178726 predicted 3410
3 SASI_Mm01_00178727 predicted 3781
4 SASI_Mm01_00178728 predicted 3404
5 SASI_Mm01_00178729 predicted 1874
6 SASI_Mm01_00178731 predicted 2556
7 SASI_Mm01_00178732 predicted 2144
8 SASI_Mm01_00178733 predicted 3933
9 SASI_Mm02_00326496 predicted 2647
10 SASI_Mm02_00326497 predicted 1930
11 SASI_Mm01_00178730 predicted 3407
12 SASI_Mm01_00178734 predicted 2378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022022
VALIDATED
UBE4B MISSION shRNA Bacterial Glycerol Stock
ubiquitination factor E4B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022022.1-3431s1c1
Sequence:CCGGCGCTATCACATTAGCACTATTCTCGAGAATAGTGCTAATGTGATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022022.1-2615s1c1
Sequence:CCGGCCGAATGATGAGACACGGATACTCGAGTATCCGTGTCTCATCATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022022.1-4115s1c1
Sequence:CCGGGCAGAAATAGACTACAGCGATCTCGAGATCGCTGTAGTCTATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022022.1-4047s1c1
Sequence:CCGGCCATCGCAATAGAGAAGTTTACTCGAGTAAACTTCTCTATTGCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022022.1-5052s1c1
Sequence:CCGGCCTTCTAGCAACCCTCAGTTACTCGAGTAACTGAGGGTTGCTAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022022.3-1880s21c1
Sequence:CCGGAGGTGTTCAAGCAGATCTTTACTCGAGTAAAGATCTGCTTGAACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022022.3-4712s21c1
Sequence:CCGGACATGTATTCTGTGCGATAACCTCGAGGTTATCGCACAGAATACATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022022.3-4598s21c1
Sequence:CCGGGAATAGAGAACTCGGACATTTCTCGAGAAATGTCCGAGTTCTCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022022.3-3577s21c1
Sequence:CCGGGAGCGTGTTTCCCGTTCTTATCTCGAGATAAGAACGGGAAACACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022022
VALIDATED
UBE4B MISSION shRNA shRNA Plasmid DNA
ubiquitination factor E4B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022022.1-3431s1c1
Sequence:CCGGCGCTATCACATTAGCACTATTCTCGAGAATAGTGCTAATGTGATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022022.1-2615s1c1
Sequence:CCGGCCGAATGATGAGACACGGATACTCGAGTATCCGTGTCTCATCATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022022.1-4115s1c1
Sequence:CCGGGCAGAAATAGACTACAGCGATCTCGAGATCGCTGTAGTCTATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022022.1-4047s1c1
Sequence:CCGGCCATCGCAATAGAGAAGTTTACTCGAGTAAACTTCTCTATTGCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022022.1-5052s1c1
Sequence:CCGGCCTTCTAGCAACCCTCAGTTACTCGAGTAACTGAGGGTTGCTAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022022.3-1880s21c1
Sequence:CCGGAGGTGTTCAAGCAGATCTTTACTCGAGTAAAGATCTGCTTGAACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022022.3-4712s21c1
Sequence:CCGGACATGTATTCTGTGCGATAACCTCGAGGTTATCGCACAGAATACATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022022.3-4598s21c1
Sequence:CCGGGAATAGAGAACTCGGACATTTCTCGAGAAATGTCCGAGTTCTCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022022.3-3577s21c1
Sequence:CCGGGAGCGTGTTTCCCGTTCTTATCTCGAGATAAGAACGGGAAACACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022022
VALIDATED
UBE4B MISSION shRNA Lentiviral Transduction Particles
ubiquitination factor E4B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022022.1-3431s1c1
Sequence:CCGGCGCTATCACATTAGCACTATTCTCGAGAATAGTGCTAATGTGATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022022.1-2615s1c1
Sequence:CCGGCCGAATGATGAGACACGGATACTCGAGTATCCGTGTCTCATCATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022022.1-4115s1c1
Sequence:CCGGGCAGAAATAGACTACAGCGATCTCGAGATCGCTGTAGTCTATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022022.1-4047s1c1
Sequence:CCGGCCATCGCAATAGAGAAGTTTACTCGAGTAAACTTCTCTATTGCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022022.1-5052s1c1
Sequence:CCGGCCTTCTAGCAACCCTCAGTTACTCGAGTAACTGAGGGTTGCTAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022022.3-1880s21c1
Sequence:CCGGAGGTGTTCAAGCAGATCTTTACTCGAGTAAAGATCTGCTTGAACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022022.3-4712s21c1
Sequence:CCGGACATGTATTCTGTGCGATAACCTCGAGGTTATCGCACAGAATACATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022022.3-4598s21c1
Sequence:CCGGGAATAGAGAACTCGGACATTTCTCGAGAAATGTCCGAGTTCTCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022022.3-3577s21c1
Sequence:CCGGGAGCGTGTTTCCCGTTCTTATCTCGAGATAAGAACGGGAAACACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006048
VALIDATED
UBE4B MISSION shRNA Bacterial Glycerol Stock
ubiquitination factor E4B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006048.2-3276s1c1
Sequence:CCGGCGCTATCATATTAGCACCATTCTCGAGAATGGTGCTAATATGATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006048.2-3876s1c1
Sequence:CCGGGCAGGGATCAAATCCACAATACTCGAGTATTGTGGATTTGATCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006048.2-949s1c1
Sequence:CCGGCGCCCTCTAATAGCCTTGAAACTCGAGTTTCAAGGCTATTAGAGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006048.2-2887s1c1
Sequence:CCGGCCGATATAACACTGCCTTTAACTCGAGTTAAAGGCAGTGTTATATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006048.2-5289s1c1
Sequence:CCGGCCCTACTTAACATACTTGAATCTCGAGATTCAAGTATGTTAAGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006048.3-1866s21c1
Sequence:CCGGGAAGTGTTCAAGCAGATATTTCTCGAGAAATATCTGCTTGAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006048.3-2636s21c1
Sequence:CCGGGCCTAGTTGCCGTCGCTATATCTCGAGATATAGCGACGGCAACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_006048.3-4584s21c1
Sequence:CCGGTAATCCAATATCCGTTGATTTCTCGAGAAATCAACGGATATTGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006048.3-3781s21c1
Sequence:CCGGTGGACCAACTGACGGATATTTCTCGAGAAATATCCGTCAGTTGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006048.3-3903s21c1
Sequence:CCGGGCAGGGATCAAATCCACAATACTCGAGTATTGTGGATTTGATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006048
VALIDATED
UBE4B MISSION shRNA shRNA Plasmid DNA
ubiquitination factor E4B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006048.2-3276s1c1
Sequence:CCGGCGCTATCATATTAGCACCATTCTCGAGAATGGTGCTAATATGATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006048.2-3876s1c1
Sequence:CCGGGCAGGGATCAAATCCACAATACTCGAGTATTGTGGATTTGATCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006048.2-949s1c1
Sequence:CCGGCGCCCTCTAATAGCCTTGAAACTCGAGTTTCAAGGCTATTAGAGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006048.2-2887s1c1
Sequence:CCGGCCGATATAACACTGCCTTTAACTCGAGTTAAAGGCAGTGTTATATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006048.2-5289s1c1
Sequence:CCGGCCCTACTTAACATACTTGAATCTCGAGATTCAAGTATGTTAAGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006048.3-1866s21c1
Sequence:CCGGGAAGTGTTCAAGCAGATATTTCTCGAGAAATATCTGCTTGAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006048.3-2636s21c1
Sequence:CCGGGCCTAGTTGCCGTCGCTATATCTCGAGATATAGCGACGGCAACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_006048.3-4584s21c1
Sequence:CCGGTAATCCAATATCCGTTGATTTCTCGAGAAATCAACGGATATTGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006048.3-3781s21c1
Sequence:CCGGTGGACCAACTGACGGATATTTCTCGAGAAATATCCGTCAGTTGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006048.3-3903s21c1
Sequence:CCGGGCAGGGATCAAATCCACAATACTCGAGTATTGTGGATTTGATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006048
VALIDATED
UBE4B MISSION shRNA Lentiviral Transduction Particles
ubiquitination factor E4B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006048.2-3276s1c1
Sequence:CCGGCGCTATCATATTAGCACCATTCTCGAGAATGGTGCTAATATGATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006048.2-3876s1c1
Sequence:CCGGGCAGGGATCAAATCCACAATACTCGAGTATTGTGGATTTGATCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006048.2-949s1c1
Sequence:CCGGCGCCCTCTAATAGCCTTGAAACTCGAGTTTCAAGGCTATTAGAGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006048.2-2887s1c1
Sequence:CCGGCCGATATAACACTGCCTTTAACTCGAGTTAAAGGCAGTGTTATATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006048.2-5289s1c1
Sequence:CCGGCCCTACTTAACATACTTGAATCTCGAGATTCAAGTATGTTAAGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006048.3-1866s21c1
Sequence:CCGGGAAGTGTTCAAGCAGATATTTCTCGAGAAATATCTGCTTGAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006048.3-2636s21c1
Sequence:CCGGGCCTAGTTGCCGTCGCTATATCTCGAGATATAGCGACGGCAACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_006048.3-4584s21c1
Sequence:CCGGTAATCCAATATCCGTTGATTTCTCGAGAAATCAACGGATATTGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006048.3-3781s21c1
Sequence:CCGGTGGACCAACTGACGGATATTTCTCGAGAAATATCCGTCAGTTGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006048.3-3903s21c1
Sequence:CCGGGCAGGGATCAAATCCACAATACTCGAGTATTGTGGATTTGATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks