EMAIL THIS PAGE TO A FRIEND

UBFD1

ubiquitin family domain containing 1

Synonyms: UBPH
UniProtKB ID: O14562, A8MW58, D3DWF2
Gene ID:
Mouse(28018) ubiquitin family domain containing 1
Rat(293454) ubiquitin family domain containing 1
cow(100125938) ubiquitin family domain containing 1
sheep(101117641) ubiquitin family domain containing 1
naked mole-rat(101718943) ubiquitin family domain containing 1
domestic guinea pig(100716586) ubiquitin family domain containing 1
Zebrafish(562437) ubiquitin family domain containing 1
chicken(771251) ubiquitin family domain containing 1
domestic cat(101089976) ubiquitin family domain containing 1
dog(479806) ubiquitin family domain containing 1
259 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019116 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138589 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138589 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138589 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026881 MISSION® esiRNA esiRNA human UBFD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019116 Rosetta Predictions human pricing
NM_001034911 Rosetta Predictions rat pricing
NM_138589 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218782 predicted 1146
2 SASI_Hs01_00218783 predicted 973
3 SASI_Hs01_00218784 predicted 1153
4 SASI_Hs01_00218785 predicted 892
5 SASI_Hs01_00218786 predicted 573
6 SASI_Hs01_00218787 predicted 711
7 SASI_Hs01_00218788 predicted 1058
8 SASI_Hs01_00218789 predicted 1059
9 SASI_Hs01_00218790 predicted 925
10 SASI_Hs01_00218791 predicted 1041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034911 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077545 predicted 415
2 SASI_Rn01_00077546 predicted 254
3 SASI_Rn01_00077547 predicted 658
4 SASI_Rn01_00077548 predicted 687
5 SASI_Rn01_00077549 predicted 340
6 SASI_Rn01_00077550 predicted 254
7 SASI_Rn01_00077551 predicted 375
8 SASI_Rn02_00204047 predicted 680
9 SASI_Rn01_00077552 predicted 667
10 SASI_Rn01_00077553 predicted 695
11 SASI_Rn01_00077554 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035977 predicted 1069
2 SASI_Mm01_00035978 predicted 940
3 SASI_Mm01_00035979 predicted 1041
4 SASI_Mm01_00035980 predicted 860
5 SASI_Mm02_00339645 predicted 1289
6 SASI_Mm01_00035981 predicted 827
7 SASI_Mm01_00035982 predicted 1099
8 SASI_Mm01_00035983 predicted 981
9 SASI_Mm01_00035984 predicted 924
10 SASI_Mm01_00035985 predicted 1127
11 SASI_Mm01_00035986 predicted 250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019116
VALIDATED
UBFD1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin family domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019116.2-1435s21c1
Sequence:CCGGAGAGTAGATCTGCCAATTATGCTCGAGCATAATTGGCAGATCTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019116.2-1289s21c1
Sequence:CCGGTACTTTCACCATTAGCTTAATCTCGAGATTAAGCTAATGGTGAAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019116.2-1340s21c1
Sequence:CCGGGCAGTCAGCTTCATACCATTTCTCGAGAAATGGTATGAAGCTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_019116.x-1371s1c1
Sequence:CCGGTAAACTAGAACAAGACCAGCTCTCGAGAGCTGGTCTTGTTCTAGTTTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019116.x-543s1c1
Sequence:CCGGCTCCATAGAAACCTCCACCTGCTCGAGCAGGTGGAGGTTTCTATGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019116.x-1187s1c1
Sequence:CCGGAGGATGCAAAGGCCGAAGAGACTCGAGTCTCTTCGGCCTTTGCATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_019116.x-1630s1c1
Sequence:CCGGCTGACCCAAAGTGAAGGACATCTCGAGATGTCCTTCACTTTGGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019116.x-1544s1c1
Sequence:CCGGCAACTCAATATGTGGATGCAACTCGAGTTGCATCCACATATTGAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019116
VALIDATED
UBFD1 MISSION shRNA shRNA Plasmid DNA
ubiquitin family domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019116.2-1435s21c1
Sequence:CCGGAGAGTAGATCTGCCAATTATGCTCGAGCATAATTGGCAGATCTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019116.2-1289s21c1
Sequence:CCGGTACTTTCACCATTAGCTTAATCTCGAGATTAAGCTAATGGTGAAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019116.2-1340s21c1
Sequence:CCGGGCAGTCAGCTTCATACCATTTCTCGAGAAATGGTATGAAGCTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_019116.x-1371s1c1
Sequence:CCGGTAAACTAGAACAAGACCAGCTCTCGAGAGCTGGTCTTGTTCTAGTTTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019116.x-543s1c1
Sequence:CCGGCTCCATAGAAACCTCCACCTGCTCGAGCAGGTGGAGGTTTCTATGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019116.x-1187s1c1
Sequence:CCGGAGGATGCAAAGGCCGAAGAGACTCGAGTCTCTTCGGCCTTTGCATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_019116.x-1630s1c1
Sequence:CCGGCTGACCCAAAGTGAAGGACATCTCGAGATGTCCTTCACTTTGGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019116.x-1544s1c1
Sequence:CCGGCAACTCAATATGTGGATGCAACTCGAGTTGCATCCACATATTGAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019116
VALIDATED
UBFD1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin family domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019116.2-1435s21c1
Sequence:CCGGAGAGTAGATCTGCCAATTATGCTCGAGCATAATTGGCAGATCTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019116.2-1289s21c1
Sequence:CCGGTACTTTCACCATTAGCTTAATCTCGAGATTAAGCTAATGGTGAAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019116.2-1340s21c1
Sequence:CCGGGCAGTCAGCTTCATACCATTTCTCGAGAAATGGTATGAAGCTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_019116.x-1371s1c1
Sequence:CCGGTAAACTAGAACAAGACCAGCTCTCGAGAGCTGGTCTTGTTCTAGTTTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019116.x-543s1c1
Sequence:CCGGCTCCATAGAAACCTCCACCTGCTCGAGCAGGTGGAGGTTTCTATGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019116.x-1187s1c1
Sequence:CCGGAGGATGCAAAGGCCGAAGAGACTCGAGTCTCTTCGGCCTTTGCATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_019116.x-1630s1c1
Sequence:CCGGCTGACCCAAAGTGAAGGACATCTCGAGATGTCCTTCACTTTGGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019116.x-1544s1c1
Sequence:CCGGCAACTCAATATGTGGATGCAACTCGAGTTGCATCCACATATTGAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138589
VALIDATED
UBFD1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin family domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138589.2-665s21c1
Sequence:CCGGGAAGACAAGACTTTGAGAGAACTCGAGTTCTCTCAAAGTCTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138589.2-1405s21c1
Sequence:CCGGGCAGTCAGCTTCATACCATTTCTCGAGAAATGGTATGAAGCTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138589.2-823s21c1
Sequence:CCGGGAAGCAACACAGGAAAGTGTTCTCGAGAACACTTTCCTGTGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138589.2-541s21c1
Sequence:CCGGCAAGACCAAACACGACGTGAACTCGAGTTCACGTCGTGTTTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138589.1-318s1c1
Sequence:CCGGCAAGACCAAACACGACGTGAACTCGAGTTCACGTCGTGTTTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138589.1-1179s1c1
Sequence:CCGGGCAGTCAGCTTCATACCATTTCTCGAGAAATGGTATGAAGCTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138589.1-442s1c1
Sequence:CCGGGAAGACAAGACTTTGAGAGAACTCGAGTTCTCTCAAAGTCTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138589.1-418s1c1
Sequence:CCGGGTCATGTATAAAGGACTTGTTCTCGAGAACAAGTCCTTTATACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138589.1-600s1c1
Sequence:CCGGGAAGCAACACAGGAAAGTGTTCTCGAGAACACTTTCCTGTGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138589
VALIDATED
UBFD1 MISSION shRNA shRNA Plasmid DNA
ubiquitin family domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138589.2-665s21c1
Sequence:CCGGGAAGACAAGACTTTGAGAGAACTCGAGTTCTCTCAAAGTCTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138589.2-1405s21c1
Sequence:CCGGGCAGTCAGCTTCATACCATTTCTCGAGAAATGGTATGAAGCTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138589.2-823s21c1
Sequence:CCGGGAAGCAACACAGGAAAGTGTTCTCGAGAACACTTTCCTGTGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138589.2-541s21c1
Sequence:CCGGCAAGACCAAACACGACGTGAACTCGAGTTCACGTCGTGTTTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138589.1-318s1c1
Sequence:CCGGCAAGACCAAACACGACGTGAACTCGAGTTCACGTCGTGTTTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138589.1-1179s1c1
Sequence:CCGGGCAGTCAGCTTCATACCATTTCTCGAGAAATGGTATGAAGCTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138589.1-442s1c1
Sequence:CCGGGAAGACAAGACTTTGAGAGAACTCGAGTTCTCTCAAAGTCTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138589.1-418s1c1
Sequence:CCGGGTCATGTATAAAGGACTTGTTCTCGAGAACAAGTCCTTTATACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138589.1-600s1c1
Sequence:CCGGGAAGCAACACAGGAAAGTGTTCTCGAGAACACTTTCCTGTGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138589
VALIDATED
UBFD1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin family domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138589.2-665s21c1
Sequence:CCGGGAAGACAAGACTTTGAGAGAACTCGAGTTCTCTCAAAGTCTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138589.2-1405s21c1
Sequence:CCGGGCAGTCAGCTTCATACCATTTCTCGAGAAATGGTATGAAGCTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138589.2-823s21c1
Sequence:CCGGGAAGCAACACAGGAAAGTGTTCTCGAGAACACTTTCCTGTGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138589.2-541s21c1
Sequence:CCGGCAAGACCAAACACGACGTGAACTCGAGTTCACGTCGTGTTTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138589.1-318s1c1
Sequence:CCGGCAAGACCAAACACGACGTGAACTCGAGTTCACGTCGTGTTTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138589.1-1179s1c1
Sequence:CCGGGCAGTCAGCTTCATACCATTTCTCGAGAAATGGTATGAAGCTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138589.1-442s1c1
Sequence:CCGGGAAGACAAGACTTTGAGAGAACTCGAGTTCTCTCAAAGTCTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138589.1-418s1c1
Sequence:CCGGGTCATGTATAAAGGACTTGTTCTCGAGAACAAGTCCTTTATACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138589.1-600s1c1
Sequence:CCGGGAAGCAACACAGGAAAGTGTTCTCGAGAACACTTTCCTGTGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks