EMAIL THIS PAGE TO A FRIEND

UBIAD1

UbiA prenyltransferase domain containing 1

Synonyms: RP4-796F18.1 SCCD TERE1
UniProtKB ID: Q9Y5Z9, B3KQG3, Q53GX3, Q5THD4
Gene ID:
Human(29914) Summary: This gene encodes a protein thought to be involved in cholesterol and phospholipid metabolism. Mutations in this gene are associated with Schnyder crystalline corneal dystrophy. [provided by RefSeq, Oct 2008]
Mouse(71707) UbiA prenyltransferase domain containing 1
Rat(313706) UbiA prenyltransferase domain containing 1
Zebrafish(558410) UbiA prenyltransferase domain containing 1
dog(487446) UbiA prenyltransferase domain containing 1
domestic cat(101099816) UbiA prenyltransferase domain containing 1
chicken(419456) UbiA prenyltransferase domain containing 1
cow(508501) UbiA prenyltransferase domain containing 1
sheep(101113087) UbiA prenyltransferase domain containing 1
domestic guinea pig(100717563) UbiA prenyltransferase domain containing 1
naked mole-rat(101724865) UbiA prenyltransferase domain containing 1
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013319 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013319 Rosetta Predictions human pricing
NM_001107993 Rosetta Predictions rat pricing
NM_027873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213123 predicted 803
2 SASI_Hs01_00213124 predicted 620
3 SASI_Hs01_00213126 predicted 1254
4 SASI_Hs01_00213127 predicted 412
5 SASI_Hs01_00213128 predicted 678
6 SASI_Hs01_00213129 predicted 624
7 SASI_Hs02_00344620 predicted 359
8 SASI_Hs01_00213130 predicted 470
9 SASI_Hs01_00213131 predicted 673
10 SASI_Hs02_00344621 predicted 709
11 SASI_Hs01_00213125 predicted 888
12 SASI_Hs01_00213132 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107993 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234305 predicted 590
2 SASI_Rn02_00234306 predicted 694
3 SASI_Rn02_00234307 predicted 1440
4 SASI_Rn02_00234308 predicted 1439
5 SASI_Rn02_00234309 predicted 732
6 SASI_Rn02_00234310 predicted 1360
7 SASI_Rn02_00234311 predicted 1453
8 SASI_Rn02_00234312 predicted 411
9 SASI_Rn02_00234313 predicted 1456
10 SASI_Rn02_00234314 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084256 predicted 1416
2 SASI_Mm01_00084257 predicted 750
3 SASI_Mm01_00084258 predicted 578
4 SASI_Mm01_00084260 predicted 645
5 SASI_Mm02_00332832 predicted 1440
6 SASI_Mm01_00084262 predicted 1062
7 SASI_Mm02_00332833 predicted 1430
8 SASI_Mm01_00084263 predicted 1467
9 SASI_Mm01_00084264 predicted 1591
10 SASI_Mm02_00332834 predicted 1467
11 SASI_Mm01_00084255 predicted 694
12 SASI_Mm01_00084259 predicted 924
13 SASI_Mm01_00084261 predicted 593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027873
VALIDATED
UBIAD1 MISSION shRNA Bacterial Glycerol Stock
UbiA prenyltransferase domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027873.1-1059s1c1
Sequence:CCGGCCTTCTCCTATGTCCTCTATACTCGAGTATAGAGGACATAGGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027873.1-931s1c1
Sequence:CCGGCTTCCCTCTAATCTACGCCATCTCGAGATGGCGTAGATTAGAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027873.1-1096s1c1
Sequence:CCGGGCCCTACCTAATCTTTACCATCTCGAGATGGTAAAGATTAGGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027873.2-678s21c1
Sequence:CCGGCCCAGGATGTTGTTCGATTTGCTCGAGCAAATCGAACAACATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027873.2-744s21c1
Sequence:CCGGACTACCTGTCCGCTCTGAAATCTCGAGATTTCAGAGCGGACAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248481    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027873.2-2382s21c1
Sequence:CCGGTGTACCCTCTCTGAGTATAACCTCGAGGTTATACTCAGAGAGGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027873.2-822s21c1
Sequence:CCGGGAGGAATTGGATTCAAGTATGCTCGAGCATACTTGAATCCAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216272    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027873.2-1685s1c1
Sequence:CCGGCGTAGGAAATTGTACTAATTGCTCGAGCAATTAGTACAATTTCCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027873.2-1092s21c1
Sequence:CCGGTTGTGCCCTACCTAATCTTTACTCGAGTAAAGATTAGGTAGGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027873
VALIDATED
UBIAD1 MISSION shRNA shRNA Plasmid DNA
UbiA prenyltransferase domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027873.1-1059s1c1
Sequence:CCGGCCTTCTCCTATGTCCTCTATACTCGAGTATAGAGGACATAGGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027873.1-931s1c1
Sequence:CCGGCTTCCCTCTAATCTACGCCATCTCGAGATGGCGTAGATTAGAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027873.1-1096s1c1
Sequence:CCGGGCCCTACCTAATCTTTACCATCTCGAGATGGTAAAGATTAGGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027873.2-678s21c1
Sequence:CCGGCCCAGGATGTTGTTCGATTTGCTCGAGCAAATCGAACAACATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027873.2-744s21c1
Sequence:CCGGACTACCTGTCCGCTCTGAAATCTCGAGATTTCAGAGCGGACAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248481    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027873.2-2382s21c1
Sequence:CCGGTGTACCCTCTCTGAGTATAACCTCGAGGTTATACTCAGAGAGGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027873.2-822s21c1
Sequence:CCGGGAGGAATTGGATTCAAGTATGCTCGAGCATACTTGAATCCAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216272    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027873.2-1685s1c1
Sequence:CCGGCGTAGGAAATTGTACTAATTGCTCGAGCAATTAGTACAATTTCCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027873.2-1092s21c1
Sequence:CCGGTTGTGCCCTACCTAATCTTTACTCGAGTAAAGATTAGGTAGGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027873
VALIDATED
UBIAD1 MISSION shRNA Lentiviral Transduction Particles
UbiA prenyltransferase domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027873.1-1059s1c1
Sequence:CCGGCCTTCTCCTATGTCCTCTATACTCGAGTATAGAGGACATAGGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027873.1-931s1c1
Sequence:CCGGCTTCCCTCTAATCTACGCCATCTCGAGATGGCGTAGATTAGAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027873.1-1096s1c1
Sequence:CCGGGCCCTACCTAATCTTTACCATCTCGAGATGGTAAAGATTAGGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027873.2-678s21c1
Sequence:CCGGCCCAGGATGTTGTTCGATTTGCTCGAGCAAATCGAACAACATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027873.2-744s21c1
Sequence:CCGGACTACCTGTCCGCTCTGAAATCTCGAGATTTCAGAGCGGACAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248481    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027873.2-2382s21c1
Sequence:CCGGTGTACCCTCTCTGAGTATAACCTCGAGGTTATACTCAGAGAGGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027873.2-822s21c1
Sequence:CCGGGAGGAATTGGATTCAAGTATGCTCGAGCATACTTGAATCCAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216272    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027873.2-1685s1c1
Sequence:CCGGCGTAGGAAATTGTACTAATTGCTCGAGCAATTAGTACAATTTCCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027873.2-1092s21c1
Sequence:CCGGTTGTGCCCTACCTAATCTTTACTCGAGTAAAGATTAGGTAGGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013319
VALIDATED
UBIAD1 MISSION shRNA Bacterial Glycerol Stock
UbiA prenyltransferase domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013319.1-844s1c1
Sequence:CCGGCCTTTCTCTACACAGGAGGAACTCGAGTTCCTCCTGTGTAGAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013319.1-362s1c1
Sequence:CCGGGATTAACATCCTGTCGGGAGACTCGAGTCTCCCGACAGGATGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013319.1-807s1c1
Sequence:CCGGCACTTGGCTCTTATCTACTTTCTCGAGAAAGTAGATAAGAGCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013319.2-375s21c1
Sequence:CCGGTGTCGGGAGAGACTGTCAAAGCTCGAGCTTTGACAGTCTCTCCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_013319.2-691s21c1
Sequence:CCGGGACACTTGTGGACCGAATCTTCTCGAGAAGATTCGGTCCACAAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_013319.2-630s21c1
Sequence:CCGGATTTGGTCAACACTTACTATGCTCGAGCATAGTAAGTGTTGACCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_013319.2-2714s21c1
Sequence:CCGGGCCATTCTAGTAGGCGTTTAACTCGAGTTAAACGCCTACTAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_013319.2-802s21c1
Sequence:CCGGACTGGAGCACTTGGCTCTTATCTCGAGATAAGAGCCAAGTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013319
VALIDATED
UBIAD1 MISSION shRNA shRNA Plasmid DNA
UbiA prenyltransferase domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013319.1-844s1c1
Sequence:CCGGCCTTTCTCTACACAGGAGGAACTCGAGTTCCTCCTGTGTAGAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013319.1-362s1c1
Sequence:CCGGGATTAACATCCTGTCGGGAGACTCGAGTCTCCCGACAGGATGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013319.1-807s1c1
Sequence:CCGGCACTTGGCTCTTATCTACTTTCTCGAGAAAGTAGATAAGAGCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013319.2-375s21c1
Sequence:CCGGTGTCGGGAGAGACTGTCAAAGCTCGAGCTTTGACAGTCTCTCCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_013319.2-691s21c1
Sequence:CCGGGACACTTGTGGACCGAATCTTCTCGAGAAGATTCGGTCCACAAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_013319.2-630s21c1
Sequence:CCGGATTTGGTCAACACTTACTATGCTCGAGCATAGTAAGTGTTGACCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_013319.2-2714s21c1
Sequence:CCGGGCCATTCTAGTAGGCGTTTAACTCGAGTTAAACGCCTACTAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_013319.2-802s21c1
Sequence:CCGGACTGGAGCACTTGGCTCTTATCTCGAGATAAGAGCCAAGTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013319
VALIDATED
UBIAD1 MISSION shRNA Lentiviral Transduction Particles
UbiA prenyltransferase domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013319.1-844s1c1
Sequence:CCGGCCTTTCTCTACACAGGAGGAACTCGAGTTCCTCCTGTGTAGAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013319.1-362s1c1
Sequence:CCGGGATTAACATCCTGTCGGGAGACTCGAGTCTCCCGACAGGATGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013319.1-807s1c1
Sequence:CCGGCACTTGGCTCTTATCTACTTTCTCGAGAAAGTAGATAAGAGCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013319.2-375s21c1
Sequence:CCGGTGTCGGGAGAGACTGTCAAAGCTCGAGCTTTGACAGTCTCTCCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_013319.2-691s21c1
Sequence:CCGGGACACTTGTGGACCGAATCTTCTCGAGAAGATTCGGTCCACAAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_013319.2-630s21c1
Sequence:CCGGATTTGGTCAACACTTACTATGCTCGAGCATAGTAAGTGTTGACCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_013319.2-2714s21c1
Sequence:CCGGGCCATTCTAGTAGGCGTTTAACTCGAGTTAAACGCCTACTAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_013319.2-802s21c1
Sequence:CCGGACTGGAGCACTTGGCTCTTATCTCGAGATAAGAGCCAAGTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks