EMAIL THIS PAGE TO A FRIEND

UBL3

ubiquitin-like 3

Synonyms: HCG-1 PNSC1
UniProtKB ID: O95164, B2R4J1, Q5RL72, Q5VZS0, Q6FIG8, Q96SG7
Gene ID:
Mouse(24109) ubiquitin-like 3
Rat(363869) ubiquitin-like 3
cow(526950) ubiquitin-like 3
sheep(101112830) ubiquitin-like 3
naked mole-rat(101707498) ubiquitin-like 3
fruit fly(32541) CG9038 gene product from transcript CG9038-RC
chicken(418921) ubiquitin-like 3
domestic cat(101089317) ubiquitin-like 3
dog(607436) ubiquitin-like 3
147 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007106 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007106 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007106 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011908 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011908 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011908 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007106 Rosetta Predictions human pricing
NM_001015030 Rosetta Predictions rat pricing
NM_011908 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101116 predicted 481
2 SASI_Hs01_00101119 predicted 1108
3 SASI_Hs01_00101121 predicted 900
4 SASI_Hs01_00101122 predicted 807
5 SASI_Hs01_00101123 predicted 583
6 SASI_Hs01_00101124 predicted 693
7 SASI_Hs01_00101125 predicted 851
8 SASI_Hs02_00342943 predicted 641
9 SASI_Hs02_00342944 predicted 570
10 SASI_Hs02_00342945 predicted 584
11 SASI_Hs01_00101117 predicted 873
12 SASI_Hs01_00101118 predicted 935
13 SASI_Hs01_00101120 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015030 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104615 predicted 1312
2 SASI_Rn01_00104616 predicted 969
3 SASI_Rn01_00104617 predicted 949
4 SASI_Rn01_00104618 predicted 1333
5 SASI_Rn01_00104619 predicted 1563
6 SASI_Rn01_00104620 predicted 1453
7 SASI_Rn02_00202145 predicted 1377
8 SASI_Rn02_00202146 predicted 1246
9 SASI_Rn01_00104623 predicted 1069
10 SASI_Rn01_00104624 predicted 1149
11 SASI_Rn01_00104621 predicted 1249
12 SASI_Rn01_00104622 predicted 1383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011908 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094643 predicted 993
2 SASI_Mm02_00321730 predicted 1636
3 SASI_Mm01_00094644 predicted 1096
4 SASI_Mm02_00321731 predicted 1397
5 SASI_Mm01_00094645 predicted 1329
6 SASI_Mm01_00094646 predicted 969
7 SASI_Mm01_00094647 predicted 1471
8 SASI_Mm01_00094648 predicted 1461
9 SASI_Mm01_00094649 predicted 1440
10 SASI_Mm01_00094650 predicted 1575
11 SASI_Mm01_00094651 predicted 1043
12 SASI_Mm01_00094652 predicted 1252
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007106
VALIDATED
UBL3 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007106.3-1294s21c1
Sequence:CCGGAGCAGGTCAGCAGTCCAAATACTCGAGTATTTGGACTGCTGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_007106.3-1251s21c1
Sequence:CCGGGCAAAGCATGTATATGACAATCTCGAGATTGTCATATACATGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_007106.3-1471s21c1
Sequence:CCGGGAGAGAGTAATTGTTGTGTAACTCGAGTTACACAACAATTACTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_007106.3-1515s21c1
Sequence:CCGGTGTGATGTGATATAGTCTTTGCTCGAGCAAAGACTATATCACATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_007106.3-1171s21c1
Sequence:CCGGTGATAAATTTGCGCCTCATTTCTCGAGAAATGAGGCGCAAATTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007657    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_007106.2-3009s1c1
Sequence:CCGGCCTCAATTTAGAGTTTGCTAACTCGAGTTAGCAAACTCTAAATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007106.2-661s1c1
Sequence:CCGGGACTTATTTATCAAGGACGATCTCGAGATCGTCCTTGATAAATAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007106.2-811s1c1
Sequence:CCGGGAGAGAGTAATTGTTGTGTAACTCGAGTTACACAACAATTACTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007106.2-591s1c1
Sequence:CCGGGCAAAGCATGTATATGACAATCTCGAGATTGTCATATACATGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007106.2-757s1c1
Sequence:CCGGGAGAGACATTACCAGAGCCAACTCGAGTTGGCTCTGGTAATGTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007106
VALIDATED
UBL3 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007106.3-1294s21c1
Sequence:CCGGAGCAGGTCAGCAGTCCAAATACTCGAGTATTTGGACTGCTGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_007106.3-1251s21c1
Sequence:CCGGGCAAAGCATGTATATGACAATCTCGAGATTGTCATATACATGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_007106.3-1471s21c1
Sequence:CCGGGAGAGAGTAATTGTTGTGTAACTCGAGTTACACAACAATTACTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_007106.3-1515s21c1
Sequence:CCGGTGTGATGTGATATAGTCTTTGCTCGAGCAAAGACTATATCACATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_007106.3-1171s21c1
Sequence:CCGGTGATAAATTTGCGCCTCATTTCTCGAGAAATGAGGCGCAAATTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007657    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_007106.2-3009s1c1
Sequence:CCGGCCTCAATTTAGAGTTTGCTAACTCGAGTTAGCAAACTCTAAATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007106.2-661s1c1
Sequence:CCGGGACTTATTTATCAAGGACGATCTCGAGATCGTCCTTGATAAATAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007106.2-811s1c1
Sequence:CCGGGAGAGAGTAATTGTTGTGTAACTCGAGTTACACAACAATTACTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007106.2-591s1c1
Sequence:CCGGGCAAAGCATGTATATGACAATCTCGAGATTGTCATATACATGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007106.2-757s1c1
Sequence:CCGGGAGAGACATTACCAGAGCCAACTCGAGTTGGCTCTGGTAATGTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007106
VALIDATED
UBL3 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007106.3-1294s21c1
Sequence:CCGGAGCAGGTCAGCAGTCCAAATACTCGAGTATTTGGACTGCTGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_007106.3-1251s21c1
Sequence:CCGGGCAAAGCATGTATATGACAATCTCGAGATTGTCATATACATGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_007106.3-1471s21c1
Sequence:CCGGGAGAGAGTAATTGTTGTGTAACTCGAGTTACACAACAATTACTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_007106.3-1515s21c1
Sequence:CCGGTGTGATGTGATATAGTCTTTGCTCGAGCAAAGACTATATCACATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_007106.3-1171s21c1
Sequence:CCGGTGATAAATTTGCGCCTCATTTCTCGAGAAATGAGGCGCAAATTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007657    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_007106.2-3009s1c1
Sequence:CCGGCCTCAATTTAGAGTTTGCTAACTCGAGTTAGCAAACTCTAAATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007106.2-661s1c1
Sequence:CCGGGACTTATTTATCAAGGACGATCTCGAGATCGTCCTTGATAAATAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007106.2-811s1c1
Sequence:CCGGGAGAGAGTAATTGTTGTGTAACTCGAGTTACACAACAATTACTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007106.2-591s1c1
Sequence:CCGGGCAAAGCATGTATATGACAATCTCGAGATTGTCATATACATGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007106.2-757s1c1
Sequence:CCGGGAGAGACATTACCAGAGCCAACTCGAGTTGGCTCTGGTAATGTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011908
VALIDATED
UBL3 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248701    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011908.2-2123s21c1
Sequence:CCGGCACTAAAGCATGAGCTAATTTCTCGAGAAATTAGCTCATGCTTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011908.2-835s21c1
Sequence:CCGGTGATTAATTTGCGCCTCATCTCTCGAGAGATGAGGCGCAAATTAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011908.2-1018s21c1
Sequence:CCGGACGTCACCCTAGGAGCATTAACTCGAGTTAATGCTCCTAGGGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011908.2-973s21c1
Sequence:CCGGCAAACATTCTTCGACTCATTTCTCGAGAAATGAGTCGAAGAATGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011908.2-910s21c1
Sequence:CCGGACATCGCAAAGCACGTGTATGCTCGAGCATACACGTGCTTTGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183164    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011908.1-1420s1c1
Sequence:CCGGGCAAGTACAATTTGCACTAAACTCGAGTTTAGTGCAAATTGTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011908.1-961s1c1
Sequence:CCGGCGTCACCCTAGGAGCATTAAACTCGAGTTTAATGCTCCTAGGGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011908.1-950s1c1
Sequence:CCGGCTACATGGAAACGTCACCCTACTCGAGTAGGGTGACGTTTCCATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011908
VALIDATED
UBL3 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248701    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011908.2-2123s21c1
Sequence:CCGGCACTAAAGCATGAGCTAATTTCTCGAGAAATTAGCTCATGCTTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011908.2-835s21c1
Sequence:CCGGTGATTAATTTGCGCCTCATCTCTCGAGAGATGAGGCGCAAATTAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011908.2-1018s21c1
Sequence:CCGGACGTCACCCTAGGAGCATTAACTCGAGTTAATGCTCCTAGGGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011908.2-973s21c1
Sequence:CCGGCAAACATTCTTCGACTCATTTCTCGAGAAATGAGTCGAAGAATGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011908.2-910s21c1
Sequence:CCGGACATCGCAAAGCACGTGTATGCTCGAGCATACACGTGCTTTGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183164    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011908.1-1420s1c1
Sequence:CCGGGCAAGTACAATTTGCACTAAACTCGAGTTTAGTGCAAATTGTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011908.1-961s1c1
Sequence:CCGGCGTCACCCTAGGAGCATTAAACTCGAGTTTAATGCTCCTAGGGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011908.1-950s1c1
Sequence:CCGGCTACATGGAAACGTCACCCTACTCGAGTAGGGTGACGTTTCCATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011908
VALIDATED
UBL3 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248701    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011908.2-2123s21c1
Sequence:CCGGCACTAAAGCATGAGCTAATTTCTCGAGAAATTAGCTCATGCTTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011908.2-835s21c1
Sequence:CCGGTGATTAATTTGCGCCTCATCTCTCGAGAGATGAGGCGCAAATTAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011908.2-1018s21c1
Sequence:CCGGACGTCACCCTAGGAGCATTAACTCGAGTTAATGCTCCTAGGGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011908.2-973s21c1
Sequence:CCGGCAAACATTCTTCGACTCATTTCTCGAGAAATGAGTCGAAGAATGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011908.2-910s21c1
Sequence:CCGGACATCGCAAAGCACGTGTATGCTCGAGCATACACGTGCTTTGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183164    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011908.1-1420s1c1
Sequence:CCGGGCAAGTACAATTTGCACTAAACTCGAGTTTAGTGCAAATTGTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011908.1-961s1c1
Sequence:CCGGCGTCACCCTAGGAGCATTAAACTCGAGTTTAATGCTCCTAGGGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011908.1-950s1c1
Sequence:CCGGCTACATGGAAACGTCACCCTACTCGAGTAGGGTGACGTTTCCATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks