EMAIL THIS PAGE TO A FRIEND

UBL4A

ubiquitin-like 4A

Synonyms: DX254E DXS254E G6PD GDX GET5 MDY2 TMA24 UBL4
UniProtKB ID: P11441, Q5HY80
Gene ID:
Mouse(100169864) Slc10a3-Ubl4 readthrough
Rat(293864) ubiquitin-like 4A
cow(504533) ubiquitin-like 4A
sheep(101118855) ubiquitin-like 4A
naked mole-rat(101708338) ubiquitin-like 4A
Domestic Rabbit(100328764) ubiquitin-like 4A
domestic guinea pig(100723318) ubiquitin-like 4A
domestic cat(101085445) ubiquitin-like 4A
dog(612563) ubiquitin-like 4A
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014235 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052691 MISSION® esiRNA esiRNA human UBL4A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014235 Rosetta Predictions human pricing
NM_001106346 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345271 predicted 522
2 SASI_Hs01_00047075 predicted 535
3 SASI_Hs01_00047076 predicted 710
4 SASI_Hs01_00047078 predicted 453
5 SASI_Hs01_00047079 predicted 549
6 SASI_Hs01_00047080 predicted 812
7 SASI_Hs01_00047081 predicted 228
8 SASI_Hs02_00345272 predicted 779
9 SASI_Hs02_00345273 predicted 783
10 SASI_Hs01_00047083 predicted 956
11 SASI_Hs01_00047077 predicted 449
12 SASI_Hs01_00047082 predicted 786
13 SASI_Hs01_00047084 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218068 predicted 618
2 SASI_Rn02_00218069 predicted 279
3 SASI_Rn02_00218070 predicted 953
4 SASI_Rn02_00218071 predicted 271
5 SASI_Rn02_00218072 predicted 745
6 SASI_Rn02_00218073 predicted 671
7 SASI_Rn02_00218074 predicted 539
8 SASI_Rn02_00218075 predicted 631
9 SASI_Rn02_00218076 predicted 777
10 SASI_Rn02_00218077 predicted 473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014235
VALIDATED
UBL4A MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like 4A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014235.3-402s21c1
Sequence:CCGGGCTGGACGACATCGAACGGTTCTCGAGAACCGTTCGATGTCGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014235.3-232s21c1
Sequence:CCGGGAGAAGGTGCTACTAGAAGAACTCGAGTTCTTCTAGTAGCACCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014235.3-441s21c1
Sequence:CCGGCCCTGAAGTGACTGAGACAATCTCGAGATTGTCTCAGTCACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014235.3-297s21c1
Sequence:CCGGGCAGCTGATCTCCAAAGTCTTCTCGAGAAGACTTTGGAGATCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014235.3-1854s21c1
Sequence:CCGGGCAGTTCAGGTGATACATTTACTCGAGTAAATGTATCACCTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014235.2-1858s1c1
Sequence:CCGGGCAGTTCAGGTGATACATTTACTCGAGTAAATGTATCACCTGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014235.2-236s1c1
Sequence:CCGGGAGAAGGTGCTACTAGAAGAACTCGAGTTCTTCTAGTAGCACCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014235.2-406s1c1
Sequence:CCGGGCTGGACGACATCGAACGGTTCTCGAGAACCGTTCGATGTCGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014235.2-301s1c1
Sequence:CCGGGCAGCTGATCTCCAAAGTCTTCTCGAGAAGACTTTGGAGATCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014235.2-445s1c1
Sequence:CCGGCCCTGAAGTGACTGAGACAATCTCGAGATTGTCTCAGTCACTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014235
VALIDATED
UBL4A MISSION shRNA shRNA Plasmid DNA
ubiquitin-like 4A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014235.3-402s21c1
Sequence:CCGGGCTGGACGACATCGAACGGTTCTCGAGAACCGTTCGATGTCGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014235.3-232s21c1
Sequence:CCGGGAGAAGGTGCTACTAGAAGAACTCGAGTTCTTCTAGTAGCACCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014235.3-441s21c1
Sequence:CCGGCCCTGAAGTGACTGAGACAATCTCGAGATTGTCTCAGTCACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014235.3-297s21c1
Sequence:CCGGGCAGCTGATCTCCAAAGTCTTCTCGAGAAGACTTTGGAGATCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014235.3-1854s21c1
Sequence:CCGGGCAGTTCAGGTGATACATTTACTCGAGTAAATGTATCACCTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014235.2-1858s1c1
Sequence:CCGGGCAGTTCAGGTGATACATTTACTCGAGTAAATGTATCACCTGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014235.2-236s1c1
Sequence:CCGGGAGAAGGTGCTACTAGAAGAACTCGAGTTCTTCTAGTAGCACCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014235.2-406s1c1
Sequence:CCGGGCTGGACGACATCGAACGGTTCTCGAGAACCGTTCGATGTCGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014235.2-301s1c1
Sequence:CCGGGCAGCTGATCTCCAAAGTCTTCTCGAGAAGACTTTGGAGATCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014235.2-445s1c1
Sequence:CCGGCCCTGAAGTGACTGAGACAATCTCGAGATTGTCTCAGTCACTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014235
VALIDATED
UBL4A MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like 4A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014235.3-402s21c1
Sequence:CCGGGCTGGACGACATCGAACGGTTCTCGAGAACCGTTCGATGTCGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014235.3-232s21c1
Sequence:CCGGGAGAAGGTGCTACTAGAAGAACTCGAGTTCTTCTAGTAGCACCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014235.3-441s21c1
Sequence:CCGGCCCTGAAGTGACTGAGACAATCTCGAGATTGTCTCAGTCACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014235.3-297s21c1
Sequence:CCGGGCAGCTGATCTCCAAAGTCTTCTCGAGAAGACTTTGGAGATCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014235.3-1854s21c1
Sequence:CCGGGCAGTTCAGGTGATACATTTACTCGAGTAAATGTATCACCTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014235.2-1858s1c1
Sequence:CCGGGCAGTTCAGGTGATACATTTACTCGAGTAAATGTATCACCTGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014235.2-236s1c1
Sequence:CCGGGAGAAGGTGCTACTAGAAGAACTCGAGTTCTTCTAGTAGCACCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014235.2-406s1c1
Sequence:CCGGGCTGGACGACATCGAACGGTTCTCGAGAACCGTTCGATGTCGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014235.2-301s1c1
Sequence:CCGGGCAGCTGATCTCCAAAGTCTTCTCGAGAAGACTTTGGAGATCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014235.2-445s1c1
Sequence:CCGGCCCTGAAGTGACTGAGACAATCTCGAGATTGTCTCAGTCACTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks