EMAIL THIS PAGE TO A FRIEND

UBL4B

ubiquitin-like 4B

UniProtKB ID: Q8N7F7
Gene ID:
Mouse(67591) ubiquitin-like 4B
Rat(684560) ubiquitin-like 4B
dog(479910) ubiquitin-like 4B
domestic guinea pig(100720756) ubiquitin-like 4B
naked mole-rat(101713490) ubiquitin-like 4B
cow(529388) ubiquitin-like 4B
sheep(101104956) ubiquitin-like 4B
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026261 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026261 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026261 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_203412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203412 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054461 MISSION® esiRNA esiRNA human UBL4B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203412 Rosetta Predictions human pricing
XM_001070979 Rosetta Predictions rat pricing
NM_026261 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212281 predicted 375
2 SASI_Hs01_00212282 predicted 279
3 SASI_Hs01_00212283 predicted 784
4 SASI_Hs01_00212284 predicted 685
5 SASI_Hs01_00212285 predicted 663
6 SASI_Hs01_00212286 predicted 490
7 SASI_Hs01_00212287 predicted 997
8 SASI_Hs01_00212288 predicted 290
9 SASI_Hs01_00212289 predicted 312
10 SASI_Hs02_00373342 predicted 369
11 SASI_Hs01_00212290 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333508 predicted 258
2 SASI_Rn02_00333509 predicted 330
3 SASI_Rn02_00333510 predicted 300
4 SASI_Rn02_00333511 predicted 305
5 SASI_Rn02_00333512 predicted 303
6 SASI_Rn02_00333513 predicted 299
7 SASI_Rn02_00333514 predicted 329
8 SASI_Rn02_00333515 predicted 271
9 SASI_Rn02_00333516 predicted 297
10 SASI_Rn02_00333517 predicted 195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026261 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173683 predicted 1038
2 SASI_Mm01_00173684 predicted 982
3 SASI_Mm01_00173686 predicted 1053
4 SASI_Mm02_00329950 predicted 890
5 SASI_Mm01_00173687 predicted 922
6 SASI_Mm01_00173688 predicted 966
7 SASI_Mm02_00329951 predicted 1029
8 SASI_Mm01_00173689 predicted 288
9 SASI_Mm01_00173691 predicted 357
10 SASI_Mm01_00173692 predicted 894
11 SASI_Mm01_00173685 predicted 1001
12 SASI_Mm01_00173690 predicted 909
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026261
UBL4B MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like 4B
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026261.1-883s1c1
Sequence:CCGGGCAGAATGATTCTAGCACCATCTCGAGATGGTGCTAGAATCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026261.1-283s1c1
Sequence:CCGGGCTGATGACAAATACCTCTCACTCGAGTGAGAGGTATTTGTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026261.1-816s1c1
Sequence:CCGGCCGTTAAGTAGCTGGAAGATACTCGAGTATCTTCCAGCTACTTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026261.1-321s1c1
Sequence:CCGGCAACGCTTCCATCAATGTCATCTCGAGATGACATTGATGGAAGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026261.1-410s1c1
Sequence:CCGGGCCAGGTTCTAGACAAACATTCTCGAGAATGTTTGTCTAGAACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026261.1-286s1c1
Sequence:CCGGGATGACAAATACCTCTCAGATCTCGAGATCTGAGAGGTATTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026261
UBL4B MISSION shRNA shRNA Plasmid DNA
ubiquitin-like 4B
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026261.1-883s1c1
Sequence:CCGGGCAGAATGATTCTAGCACCATCTCGAGATGGTGCTAGAATCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026261.1-283s1c1
Sequence:CCGGGCTGATGACAAATACCTCTCACTCGAGTGAGAGGTATTTGTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026261.1-816s1c1
Sequence:CCGGCCGTTAAGTAGCTGGAAGATACTCGAGTATCTTCCAGCTACTTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026261.1-321s1c1
Sequence:CCGGCAACGCTTCCATCAATGTCATCTCGAGATGACATTGATGGAAGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026261.1-410s1c1
Sequence:CCGGGCCAGGTTCTAGACAAACATTCTCGAGAATGTTTGTCTAGAACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026261.1-286s1c1
Sequence:CCGGGATGACAAATACCTCTCAGATCTCGAGATCTGAGAGGTATTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026261
UBL4B MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like 4B
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026261.1-883s1c1
Sequence:CCGGGCAGAATGATTCTAGCACCATCTCGAGATGGTGCTAGAATCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026261.1-283s1c1
Sequence:CCGGGCTGATGACAAATACCTCTCACTCGAGTGAGAGGTATTTGTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026261.1-816s1c1
Sequence:CCGGCCGTTAAGTAGCTGGAAGATACTCGAGTATCTTCCAGCTACTTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026261.1-321s1c1
Sequence:CCGGCAACGCTTCCATCAATGTCATCTCGAGATGACATTGATGGAAGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026261.1-410s1c1
Sequence:CCGGGCCAGGTTCTAGACAAACATTCTCGAGAATGTTTGTCTAGAACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026261.1-286s1c1
Sequence:CCGGGATGACAAATACCTCTCAGATCTCGAGATCTGAGAGGTATTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203412
UBL4B MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like 4B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203412.1-795s1c1
Sequence:CCGGCCCTCTGAAATGCAGAGTGAACTCGAGTTCACTCTGCATTTCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203412.1-384s1c1
Sequence:CCGGGTCCTAGCTAAACACTTTGAACTCGAGTTCAAAGTGTTTAGCTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203412.1-314s1c1
Sequence:CCGGCTTGGAGAAGATGGCGCTAAACTCGAGTTTAGCGCCATCTTCTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203412.1-296s1c1
Sequence:CCGGCAATGTCATCATGCAGCCCTTCTCGAGAAGGGCTGCATGATGACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203412.1-258s1c1
Sequence:CCGGCACCTCTCTGACTACTGCATTCTCGAGAATGCAGTAGTCAGAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203412.1-145s21c1
Sequence:CCGGTGTCAGGGCAAGAGAGTGTAGCTCGAGCTACACTCTCTTGCCCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203412.1-1026s21c1
Sequence:CCGGCATCCTCAGACCGTGACATCTCTCGAGAGATGTCACGGTCTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203412
UBL4B MISSION shRNA shRNA Plasmid DNA
ubiquitin-like 4B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203412.1-795s1c1
Sequence:CCGGCCCTCTGAAATGCAGAGTGAACTCGAGTTCACTCTGCATTTCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203412.1-384s1c1
Sequence:CCGGGTCCTAGCTAAACACTTTGAACTCGAGTTCAAAGTGTTTAGCTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203412.1-314s1c1
Sequence:CCGGCTTGGAGAAGATGGCGCTAAACTCGAGTTTAGCGCCATCTTCTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203412.1-296s1c1
Sequence:CCGGCAATGTCATCATGCAGCCCTTCTCGAGAAGGGCTGCATGATGACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203412.1-258s1c1
Sequence:CCGGCACCTCTCTGACTACTGCATTCTCGAGAATGCAGTAGTCAGAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203412.1-145s21c1
Sequence:CCGGTGTCAGGGCAAGAGAGTGTAGCTCGAGCTACACTCTCTTGCCCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203412.1-1026s21c1
Sequence:CCGGCATCCTCAGACCGTGACATCTCTCGAGAGATGTCACGGTCTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203412
UBL4B MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like 4B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203412.1-795s1c1
Sequence:CCGGCCCTCTGAAATGCAGAGTGAACTCGAGTTCACTCTGCATTTCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203412.1-384s1c1
Sequence:CCGGGTCCTAGCTAAACACTTTGAACTCGAGTTCAAAGTGTTTAGCTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203412.1-314s1c1
Sequence:CCGGCTTGGAGAAGATGGCGCTAAACTCGAGTTTAGCGCCATCTTCTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203412.1-296s1c1
Sequence:CCGGCAATGTCATCATGCAGCCCTTCTCGAGAAGGGCTGCATGATGACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203412.1-258s1c1
Sequence:CCGGCACCTCTCTGACTACTGCATTCTCGAGAATGCAGTAGTCAGAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203412.1-145s21c1
Sequence:CCGGTGTCAGGGCAAGAGAGTGTAGCTCGAGCTACACTCTCTTGCCCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203412.1-1026s21c1
Sequence:CCGGCATCCTCAGACCGTGACATCTCTCGAGAGATGTCACGGTCTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks