EMAIL THIS PAGE TO A FRIEND

UBL5

ubiquitin-like 5

Synonyms: HUB1
UniProtKB ID: Q9BZL1, Q2NL89
Gene ID:
Human(59286) Summary: This gene encodes a member of a group of proteins similar to ubiquitin. The encoded protein is not thought to degrade proteins like ubiquitin but to affect their function through being bound to target proteins by an isopeptide bond. The gene product has been studied as a link to predisposition to obesity based on its expression in Psammomys obesus, the fat sand rat, which is an animal model for obesity studies. Variation in this gene was found to be significantly associated with some metabolic traits (PMID: 15331561) but not associated with childhood obesity (PMID: 19189687). Pseudogenes of this gene are located on chromosomes 3, 5 and 17. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2013]
Mouse(66177) ubiquitin-like 5
Rat(500954) ubiquitin-like 5
cow(614551) ubiquitin-like 5
Goat(100861401) ubiquitin-like 5
sheep(101110503) ubiquitin-like 5
naked mole-rat(101707805) ubiquitin-like 5
Thale Cress(834235) ubiquitin-like protein 5
domestic cat(101087642) ubiquitin-like 5
dog(611310) ubiquitin-like 5
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025401 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025401 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025401 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024292 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024292 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024292 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122201 MISSION® esiRNA esiRNA human UBL5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001048241 Rosetta Predictions human pricing
NM_024292 Rosetta Predictions human pricing
NM_001048243 Rosetta Predictions rat pricing
NM_025401 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311802 predicted 206
2 SASI_Hs02_00311803 predicted 205
3 SASI_Hs02_00311804 predicted 219
4 SASI_Hs02_00311805 predicted 211
5 SASI_Hs02_00311806 predicted 201
6 SASI_Hs02_00311807 predicted 199
7 SASI_Hs02_00311808 predicted 199
8 SASI_Hs02_00311809 predicted 212
9 SASI_Hs02_00311810 predicted 196
10 SASI_Hs02_00311811 predicted 201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356622 predicted 225
2 SASI_Hs01_00142227 predicted 286
3 SASI_Hs02_00356623 predicted 220
4 SASI_Hs02_00356624 predicted 299
5 SASI_Hs01_00142228 predicted 289
6 SASI_Hs01_00142230 predicted 281
7 SASI_Hs01_00142231 predicted 272
8 SASI_Hs01_00142232 predicted 285
9 SASI_Hs01_00142233 predicted 263
10 SASI_Hs01_00142234 predicted 277
11 SASI_Hs01_00142225 predicted 244
12 SASI_Hs01_00142226 predicted 221
13 SASI_Hs01_00142229 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207432 predicted 173
2 SASI_Rn02_00207433 predicted 153
3 SASI_Rn02_00207434 predicted 127
4 SASI_Rn02_00207435 predicted 150
5 SASI_Rn02_00207436 predicted 231
6 SASI_Rn02_00207437 predicted 220
7 SASI_Rn02_00207438 predicted 271
8 SASI_Rn02_00207439 predicted 125
9 SASI_Rn02_00207440 predicted 124
10 SASI_Rn02_00207441 predicted 196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025401 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328153 predicted 1597
2 SASI_Mm01_00115317 predicted 1627
3 SASI_Mm01_00115319 predicted 1613
4 SASI_Mm01_00115321 predicted 1602
5 SASI_Mm01_00115324 predicted 1617
6 SASI_Mm02_00328154 predicted 1616
7 SASI_Mm02_00328155 predicted 1597
8 SASI_Mm01_00115315 predicted 1691
9 SASI_Mm01_00115318 predicted 1701
10 SASI_Mm01_00115323 predicted 1692
11 SASI_Mm01_00115316 predicted 1655
12 SASI_Mm01_00115320 predicted 1637
13 SASI_Mm01_00115322 predicted 1642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025401
UBL5 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025401.3-1617s21c1
Sequence:CCGGCGGAAAGAAAGTCCGCGTTAACTCGAGTTAACGCGGACTTTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025401.3-1647s21c1
Sequence:CCGGCGATGACACCATCGGCGACTTCTCGAGAAGTCGCCGATGGTGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025401.3-1659s21c1
Sequence:CCGGCGGCGACTTGAAGAAACTGATCTCGAGATCAGTTTCTTCAAGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025401.3-1788s21c1
Sequence:CCGGCCTGGAGCTTTATTACCAGTACTCGAGTACTGGTAATAAAGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025401.3-1699s21c1
Sequence:CCGGCGCTGGAACAAGATCGTTCTTCTCGAGAAGAACGATCTTGTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025401.2-1618s1c1
Sequence:CCGGCGGAAAGAAAGTCCGCGTTAACTCGAGTTAACGCGGACTTTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025401.2-1660s1c1
Sequence:CCGGCGGCGACTTGAAGAAACTGATCTCGAGATCAGTTTCTTCAAGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025401.2-1700s1c1
Sequence:CCGGCGCTGGAACAAGATCGTTCTTCTCGAGAAGAACGATCTTGTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025401.2-1648s1c1
Sequence:CCGGCGATGACACCATCGGCGACTTCTCGAGAAGTCGCCGATGGTGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025401.2-1789s1c1
Sequence:CCGGCCTGGAGCTTTATTACCAGTACTCGAGTACTGGTAATAAAGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025401
UBL5 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025401.3-1617s21c1
Sequence:CCGGCGGAAAGAAAGTCCGCGTTAACTCGAGTTAACGCGGACTTTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025401.3-1647s21c1
Sequence:CCGGCGATGACACCATCGGCGACTTCTCGAGAAGTCGCCGATGGTGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025401.3-1659s21c1
Sequence:CCGGCGGCGACTTGAAGAAACTGATCTCGAGATCAGTTTCTTCAAGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025401.3-1788s21c1
Sequence:CCGGCCTGGAGCTTTATTACCAGTACTCGAGTACTGGTAATAAAGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025401.3-1699s21c1
Sequence:CCGGCGCTGGAACAAGATCGTTCTTCTCGAGAAGAACGATCTTGTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025401.2-1618s1c1
Sequence:CCGGCGGAAAGAAAGTCCGCGTTAACTCGAGTTAACGCGGACTTTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025401.2-1660s1c1
Sequence:CCGGCGGCGACTTGAAGAAACTGATCTCGAGATCAGTTTCTTCAAGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025401.2-1700s1c1
Sequence:CCGGCGCTGGAACAAGATCGTTCTTCTCGAGAAGAACGATCTTGTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025401.2-1648s1c1
Sequence:CCGGCGATGACACCATCGGCGACTTCTCGAGAAGTCGCCGATGGTGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025401.2-1789s1c1
Sequence:CCGGCCTGGAGCTTTATTACCAGTACTCGAGTACTGGTAATAAAGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025401
UBL5 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025401.3-1617s21c1
Sequence:CCGGCGGAAAGAAAGTCCGCGTTAACTCGAGTTAACGCGGACTTTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025401.3-1647s21c1
Sequence:CCGGCGATGACACCATCGGCGACTTCTCGAGAAGTCGCCGATGGTGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025401.3-1659s21c1
Sequence:CCGGCGGCGACTTGAAGAAACTGATCTCGAGATCAGTTTCTTCAAGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025401.3-1788s21c1
Sequence:CCGGCCTGGAGCTTTATTACCAGTACTCGAGTACTGGTAATAAAGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025401.3-1699s21c1
Sequence:CCGGCGCTGGAACAAGATCGTTCTTCTCGAGAAGAACGATCTTGTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025401.2-1618s1c1
Sequence:CCGGCGGAAAGAAAGTCCGCGTTAACTCGAGTTAACGCGGACTTTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025401.2-1660s1c1
Sequence:CCGGCGGCGACTTGAAGAAACTGATCTCGAGATCAGTTTCTTCAAGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025401.2-1700s1c1
Sequence:CCGGCGCTGGAACAAGATCGTTCTTCTCGAGAAGAACGATCTTGTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025401.2-1648s1c1
Sequence:CCGGCGATGACACCATCGGCGACTTCTCGAGAAGTCGCCGATGGTGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025401.2-1789s1c1
Sequence:CCGGCCTGGAGCTTTATTACCAGTACTCGAGTACTGGTAATAAAGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024292
VALIDATED
UBL5 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024292.3-295s21c1
Sequence:CCGGCCGTTGGAACAAGATTGTCCTCTCGAGAGGACAATCTTGTTCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024292.3-307s21c1
Sequence:CCGGGATTGTCCTGAAGAAGTGGTACTCGAGTACCACTTCTTCAGGACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024292.3-361s21c1
Sequence:CCGGCTATGAAATCCACGATGGGATCTCGAGATCCCATCGTGGATTTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024292.3-376s21c1
Sequence:CCGGTGGGATGAACCTGGAGCTTTACTCGAGTAAAGCTCCAGGTTCATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024292.1-108s1c1
Sequence:CCGGCGCGTTAAATGCAACACGGATCTCGAGATCCGTGTTGCATTTAACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024292.1-257s1c1
Sequence:CCGGTGGGATGAACCTGGAGCTTTACTCGAGTAAAGCTCCAGGTTCATCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024292.1-188s1c1
Sequence:CCGGGATTGTCCTGAAGAAGTGGTACTCGAGTACCACTTCTTCAGGACAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024292.1-242s1c1
Sequence:CCGGCTATGAAATCCACGATGGGATCTCGAGATCCCATCGTGGATTTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024292.1-176s1c1
Sequence:CCGGCCGTTGGAACAAGATTGTCCTCTCGAGAGGACAATCTTGTTCCAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024292
VALIDATED
UBL5 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024292.3-295s21c1
Sequence:CCGGCCGTTGGAACAAGATTGTCCTCTCGAGAGGACAATCTTGTTCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024292.3-307s21c1
Sequence:CCGGGATTGTCCTGAAGAAGTGGTACTCGAGTACCACTTCTTCAGGACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024292.3-361s21c1
Sequence:CCGGCTATGAAATCCACGATGGGATCTCGAGATCCCATCGTGGATTTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024292.3-376s21c1
Sequence:CCGGTGGGATGAACCTGGAGCTTTACTCGAGTAAAGCTCCAGGTTCATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024292.1-108s1c1
Sequence:CCGGCGCGTTAAATGCAACACGGATCTCGAGATCCGTGTTGCATTTAACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024292.1-257s1c1
Sequence:CCGGTGGGATGAACCTGGAGCTTTACTCGAGTAAAGCTCCAGGTTCATCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024292.1-188s1c1
Sequence:CCGGGATTGTCCTGAAGAAGTGGTACTCGAGTACCACTTCTTCAGGACAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024292.1-242s1c1
Sequence:CCGGCTATGAAATCCACGATGGGATCTCGAGATCCCATCGTGGATTTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024292.1-176s1c1
Sequence:CCGGCCGTTGGAACAAGATTGTCCTCTCGAGAGGACAATCTTGTTCCAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024292
VALIDATED
UBL5 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024292.3-295s21c1
Sequence:CCGGCCGTTGGAACAAGATTGTCCTCTCGAGAGGACAATCTTGTTCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024292.3-307s21c1
Sequence:CCGGGATTGTCCTGAAGAAGTGGTACTCGAGTACCACTTCTTCAGGACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024292.3-361s21c1
Sequence:CCGGCTATGAAATCCACGATGGGATCTCGAGATCCCATCGTGGATTTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024292.3-376s21c1
Sequence:CCGGTGGGATGAACCTGGAGCTTTACTCGAGTAAAGCTCCAGGTTCATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024292.1-108s1c1
Sequence:CCGGCGCGTTAAATGCAACACGGATCTCGAGATCCGTGTTGCATTTAACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024292.1-257s1c1
Sequence:CCGGTGGGATGAACCTGGAGCTTTACTCGAGTAAAGCTCCAGGTTCATCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024292.1-188s1c1
Sequence:CCGGGATTGTCCTGAAGAAGTGGTACTCGAGTACCACTTCTTCAGGACAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024292.1-242s1c1
Sequence:CCGGCTATGAAATCCACGATGGGATCTCGAGATCCCATCGTGGATTTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024292.1-176s1c1
Sequence:CCGGCCGTTGGAACAAGATTGTCCTCTCGAGAGGACAATCTTGTTCCAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks