EMAIL THIS PAGE TO A FRIEND

UBL7

ubiquitin-like 7 (bone marrow stromal cell-derived)

Synonyms: BMSC-UbP TCBA1
UniProtKB ID: Q96S82, D3DW57, Q96I03
Gene ID:
Mouse(69459) ubiquitin-like 7 (bone marrow stromal cell-derived)
Rat(300744) ubiquitin-like 7 (bone marrow stromal cell-derived)
Zebrafish(393331) ubiquitin-like 7
domestic cat(101085379) ubiquitin-like 7 (bone marrow stromal cell-derived)
dog(478366) ubiquitin-like 7 (bone marrow stromal cell-derived)
chicken(415297) ubiquitin-like 7 (bone marrow stromal cell-derived)
domestic guinea pig(100725708) ubiquitin-like 7 (bone marrow stromal cell-derived)
naked mole-rat(101702681) ubiquitin-like 7 (bone marrow stromal cell-derived)
cow(511289) ubiquitin-like 7 (bone marrow stromal cell-derived)
sheep(101110623) ubiquitin-like 7 (bone marrow stromal cell-derived)
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032907 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027086 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027086 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027086 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032907 Rosetta Predictions human pricing
NM_201265 Rosetta Predictions human pricing
NM_001004247 Rosetta Predictions rat pricing
NM_001122873 Rosetta Predictions mouse pricing
NM_027086 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140951 predicted 416
2 SASI_Hs01_00140953 predicted 669
3 SASI_Hs01_00140955 predicted 799
4 SASI_Hs01_00140956 predicted 395
5 SASI_Hs01_00140957 predicted 722
6 SASI_Hs01_00140958 predicted 474
7 SASI_Hs02_00360529 predicted 516
8 SASI_Hs01_00140959 predicted 486
9 SASI_Hs01_00140960 predicted 478
10 SASI_Hs02_00360530 predicted 334
11 SASI_Hs01_00140952 predicted 390
12 SASI_Hs01_00140954 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046618 predicted 360
2 SASI_Hs01_00046620 predicted 621
3 SASI_Hs01_00046622 predicted 754
4 SASI_Hs01_00046623 predicted 342
5 SASI_Hs01_00046624 predicted 663
6 SASI_Hs01_00046625 predicted 413
7 SASI_Hs02_00372910 predicted 461
8 SASI_Hs01_00046626 predicted 438
9 SASI_Hs01_00046627 predicted 427
10 SASI_Hs02_00372911 predicted 284
11 SASI_Hs01_00046619 predicted 329
12 SASI_Hs01_00046621 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004247 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120415 predicted 943
2 SASI_Rn01_00120416 predicted 315
3 SASI_Rn01_00120418 predicted 347
4 SASI_Rn01_00120419 predicted 1026
5 SASI_Rn01_00120420 predicted 330
6 SASI_Rn01_00120421 predicted 300
7 SASI_Rn02_00198261 predicted 1135
8 SASI_Rn01_00120422 predicted 608
9 SASI_Rn01_00120423 predicted 740
10 SASI_Rn01_00120424 predicted 506
11 SASI_Rn01_00120417 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309519 predicted 823
2 SASI_Mm02_00309520 predicted 482
3 SASI_Mm02_00309521 predicted 285
4 SASI_Mm02_00309522 predicted 821
5 SASI_Mm02_00309523 predicted 276
6 SASI_Mm02_00309524 predicted 333
7 SASI_Mm02_00309525 predicted 739
8 SASI_Mm02_00309526 predicted 930
9 SASI_Mm02_00309527 predicted 506
10 SASI_Mm02_00309528 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027086 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160713 predicted 768
2 SASI_Mm01_00160714 predicted 433
3 SASI_Mm01_00160715 predicted 239
4 SASI_Mm01_00160716 predicted 763
5 SASI_Mm01_00160717 predicted 223
6 SASI_Mm01_00160718 predicted 288
7 SASI_Mm01_00160719 predicted 689
8 SASI_Mm01_00160720 predicted 876
9 SASI_Mm01_00160721 predicted 459
10 SASI_Mm02_00331511 predicted 225
11 SASI_Mm01_00160712 predicted 553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032907
VALIDATED
UBL7 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like 7 (bone marrow stromal cell-derived)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011132    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032907.3-687s1c1
Sequence:CCGGACACTTGACTTCTATGGCATTCTCGAGAATGCCATAGAAGTCAAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011134    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032907.3-650s1c1
Sequence:CCGGTCTGATCTACTGTGGTCGGAACTCGAGTTCCGACCACAGTAGATCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011135    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032907.3-719s1c1
Sequence:CCGGCACTGTCCATGTTCTGCGAAACTCGAGTTTCGCAGAACATGGACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011136    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032907.3-791s1c1
Sequence:CCGGCATGAGAGAGTTCCGGGTGTTCTCGAGAACACCCGGAACTCTCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011133    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032907.3-1011s1c1
Sequence:CCGGCCAGCCCTCGTCAATGCCATTCTCGAGAATGGCATTGACGAGGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032907.3-536s21c1
Sequence:CCGGCTTACAGGGAGGCGGTCTTTACTCGAGTAAAGACCGCCTCCCTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032907.3-443s21c1
Sequence:CCGGGGCCTGAACCTGATCAGAAACCTCGAGGTTTCTGATCAGGTTCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032907.3-664s21c1
Sequence:CCGGGTCTTCGCTGATCCCAATATGCTCGAGCATATTGGGATCAGCGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032907.3-208s21c1
Sequence:CCGGCCACTTACTCCAAAGTCTATTCTCGAGAATAGACTTTGGAGTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032907.3-284s21c1
Sequence:CCGGCATTTCTGAAGCAGCTTATTGCTCGAGCAATAAGCTGCTTCAGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032907.3-240s21c1
Sequence:CCGGAGAGACAGAACTGGGAGAATACTCGAGTATTCTCCCAGTTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032907
VALIDATED
UBL7 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like 7 (bone marrow stromal cell-derived)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011132    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032907.3-687s1c1
Sequence:CCGGACACTTGACTTCTATGGCATTCTCGAGAATGCCATAGAAGTCAAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011134    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032907.3-650s1c1
Sequence:CCGGTCTGATCTACTGTGGTCGGAACTCGAGTTCCGACCACAGTAGATCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011135    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032907.3-719s1c1
Sequence:CCGGCACTGTCCATGTTCTGCGAAACTCGAGTTTCGCAGAACATGGACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011136    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032907.3-791s1c1
Sequence:CCGGCATGAGAGAGTTCCGGGTGTTCTCGAGAACACCCGGAACTCTCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011133    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032907.3-1011s1c1
Sequence:CCGGCCAGCCCTCGTCAATGCCATTCTCGAGAATGGCATTGACGAGGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032907.3-536s21c1
Sequence:CCGGCTTACAGGGAGGCGGTCTTTACTCGAGTAAAGACCGCCTCCCTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032907.3-443s21c1
Sequence:CCGGGGCCTGAACCTGATCAGAAACCTCGAGGTTTCTGATCAGGTTCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032907.3-664s21c1
Sequence:CCGGGTCTTCGCTGATCCCAATATGCTCGAGCATATTGGGATCAGCGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032907.3-208s21c1
Sequence:CCGGCCACTTACTCCAAAGTCTATTCTCGAGAATAGACTTTGGAGTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032907.3-284s21c1
Sequence:CCGGCATTTCTGAAGCAGCTTATTGCTCGAGCAATAAGCTGCTTCAGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032907.3-240s21c1
Sequence:CCGGAGAGACAGAACTGGGAGAATACTCGAGTATTCTCCCAGTTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032907
VALIDATED
UBL7 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like 7 (bone marrow stromal cell-derived)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011132    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032907.3-687s1c1
Sequence:CCGGACACTTGACTTCTATGGCATTCTCGAGAATGCCATAGAAGTCAAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011134    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032907.3-650s1c1
Sequence:CCGGTCTGATCTACTGTGGTCGGAACTCGAGTTCCGACCACAGTAGATCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011135    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032907.3-719s1c1
Sequence:CCGGCACTGTCCATGTTCTGCGAAACTCGAGTTTCGCAGAACATGGACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011136    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032907.3-791s1c1
Sequence:CCGGCATGAGAGAGTTCCGGGTGTTCTCGAGAACACCCGGAACTCTCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011133    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032907.3-1011s1c1
Sequence:CCGGCCAGCCCTCGTCAATGCCATTCTCGAGAATGGCATTGACGAGGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032907.3-536s21c1
Sequence:CCGGCTTACAGGGAGGCGGTCTTTACTCGAGTAAAGACCGCCTCCCTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032907.3-443s21c1
Sequence:CCGGGGCCTGAACCTGATCAGAAACCTCGAGGTTTCTGATCAGGTTCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032907.3-664s21c1
Sequence:CCGGGTCTTCGCTGATCCCAATATGCTCGAGCATATTGGGATCAGCGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032907.3-208s21c1
Sequence:CCGGCCACTTACTCCAAAGTCTATTCTCGAGAATAGACTTTGGAGTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032907.3-284s21c1
Sequence:CCGGCATTTCTGAAGCAGCTTATTGCTCGAGCAATAAGCTGCTTCAGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032907.3-240s21c1
Sequence:CCGGAGAGACAGAACTGGGAGAATACTCGAGTATTCTCCCAGTTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027086
VALIDATED
UBL7 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like 7 (bone marrow stromal cell-derived)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000176201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027086.1-464s1c1
Sequence:CCGGGAATCTCTGGATCAGATCATTCTCGAGAATGATCTGATCCAGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027086.1-440s1c1
Sequence:CCGGGTCTTTAAGATGCTCAGCAATCTCGAGATTGCTGAGCATCTTAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027086.1-550s1c1
Sequence:CCGGCTCTGTCTTTGCTGATCCCAACTCGAGTTGGGATCAGCAAAGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027086.1-451s1c1
Sequence:CCGGGCTCAGCAATAAAGAATCTCTCTCGAGAGAGATTCTTTATTGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027086
VALIDATED
UBL7 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like 7 (bone marrow stromal cell-derived)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000176201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027086.1-464s1c1
Sequence:CCGGGAATCTCTGGATCAGATCATTCTCGAGAATGATCTGATCCAGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027086.1-440s1c1
Sequence:CCGGGTCTTTAAGATGCTCAGCAATCTCGAGATTGCTGAGCATCTTAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027086.1-550s1c1
Sequence:CCGGCTCTGTCTTTGCTGATCCCAACTCGAGTTGGGATCAGCAAAGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027086.1-451s1c1
Sequence:CCGGGCTCAGCAATAAAGAATCTCTCTCGAGAGAGATTCTTTATTGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027086
VALIDATED
UBL7 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like 7 (bone marrow stromal cell-derived)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000176201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027086.1-464s1c1
Sequence:CCGGGAATCTCTGGATCAGATCATTCTCGAGAATGATCTGATCCAGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027086.1-440s1c1
Sequence:CCGGGTCTTTAAGATGCTCAGCAATCTCGAGATTGCTGAGCATCTTAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027086.1-550s1c1
Sequence:CCGGCTCTGTCTTTGCTGATCCCAACTCGAGTTGGGATCAGCAAAGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027086.1-451s1c1
Sequence:CCGGGCTCAGCAATAAAGAATCTCTCTCGAGAGAGATTCTTTATTGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks