EMAIL THIS PAGE TO A FRIEND

UBLCP1

ubiquitin-like domain containing CTD phosphatase 1

Synonyms: CPUB1
UniProtKB ID: Q8WVY7, D3DQJ7, Q96DK5
Gene ID:
Mouse(79560) ubiquitin-like domain containing CTD phosphatase 1
Rat(360514) ubiquitin-like domain containing CTD phosphatase 1
fruit fly(42726) Ubiquitin-like domain-containing C-terminal domain phosphatase 1
domestic cat(101081954) ubiquitin-like domain containing CTD phosphatase 1
dog(489153) ubiquitin-like domain containing CTD phosphatase 1
chicken(416237) ubiquitin-like domain containing CTD phosphatase 1
Zebrafish(792145) ubiquitin-like domain containing CTD phosphatase 1
cow(508163) ubiquitin-like domain containing CTD phosphatase 1
sheep(101115364) ubiquitin-like domain containing CTD phosphatase 1
naked mole-rat(101701660) ubiquitin-like domain containing CTD phosphatase 1
domestic guinea pig(100733805) ubiquitin-like domain containing CTD phosphatase 1
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145049 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145049 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145049 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024475 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024475 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024475 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145049 Rosetta Predictions human pricing
NM_001014117 Rosetta Predictions rat pricing
NM_024475 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058682 predicted 378
2 SASI_Hs01_00058683 predicted 286
3 SASI_Hs01_00058684 predicted 756
4 SASI_Hs01_00058685 predicted 713
5 SASI_Hs02_00364930 predicted 388
6 SASI_Hs01_00058686 predicted 629
7 SASI_Hs01_00058687 predicted 741
8 SASI_Hs01_00058688 predicted 893
9 SASI_Hs01_00058689 predicted 645
10 SASI_Hs02_00364931 predicted 536
11 SASI_Hs01_00058681 predicted 488
12 SASI_Hs01_00058690 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064329 predicted 201
2 SASI_Rn01_00064330 predicted 247
3 SASI_Rn01_00064331 predicted 379
4 SASI_Rn02_00201559 predicted 342
5 SASI_Rn01_00064332 predicted 519
6 SASI_Rn01_00064333 predicted 574
7 SASI_Rn01_00064334 predicted 522
8 SASI_Rn01_00064336 predicted 991
9 SASI_Rn01_00064337 predicted 725
10 SASI_Rn01_00064338 predicted 1013
11 SASI_Rn01_00064335 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096955 predicted 667
2 SASI_Mm01_00096956 predicted 652
3 SASI_Mm01_00096957 predicted 503
4 SASI_Mm01_00096958 predicted 235
5 SASI_Mm01_00096959 predicted 795
6 SASI_Mm01_00096960 predicted 353
7 SASI_Mm01_00096961 predicted 460
8 SASI_Mm01_00096962 predicted 847
9 SASI_Mm02_00327859 predicted 328
10 SASI_Mm01_00096963 predicted 578
11 SASI_Mm01_00096964 predicted 546
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145049
VALIDATED
UBLCP1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like domain containing CTD phosphatase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145049.3-1287s21c1
Sequence:CCGGCAAGTTATACTGGCAGTTATTCTCGAGAATAACTGCCAGTATAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145049.3-1012s21c1
Sequence:CCGGTAAAGCCTCTTGGTGTTATATCTCGAGATATAACACCAAGAGGCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145049.3-1782s21c1
Sequence:CCGGACCTAGTTTGCTATGCTTAAACTCGAGTTTAAGCATAGCAAACTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145049.3-838s21c1
Sequence:CCGGCATCTGCCTATGAAGATTATGCTCGAGCATAATCTTCATAGGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145049.1-1744s1c1
Sequence:CCGGGCTGTGTCTTAGTATGAGAAACTCGAGTTTCTCATACTAAGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145049.1-475s1c1
Sequence:CCGGCGCAGAGTGAAAGAGTACAAACTCGAGTTTGTACTCTTTCACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145049.1-304s1c1
Sequence:CCGGGCTCTCAAACTGAAACCAAATCTCGAGATTTGGTTTCAGTTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145049.1-604s1c1
Sequence:CCGGCGGCCATATCTTCATGAATTTCTCGAGAAATTCATGAAGATATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145049.1-937s1c1
Sequence:CCGGGCGCACCTAAATCGTGATAAACTCGAGTTTATCACGATTTAGGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145049
VALIDATED
UBLCP1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like domain containing CTD phosphatase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145049.3-1287s21c1
Sequence:CCGGCAAGTTATACTGGCAGTTATTCTCGAGAATAACTGCCAGTATAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145049.3-1012s21c1
Sequence:CCGGTAAAGCCTCTTGGTGTTATATCTCGAGATATAACACCAAGAGGCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145049.3-1782s21c1
Sequence:CCGGACCTAGTTTGCTATGCTTAAACTCGAGTTTAAGCATAGCAAACTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145049.3-838s21c1
Sequence:CCGGCATCTGCCTATGAAGATTATGCTCGAGCATAATCTTCATAGGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145049.1-1744s1c1
Sequence:CCGGGCTGTGTCTTAGTATGAGAAACTCGAGTTTCTCATACTAAGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145049.1-475s1c1
Sequence:CCGGCGCAGAGTGAAAGAGTACAAACTCGAGTTTGTACTCTTTCACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145049.1-304s1c1
Sequence:CCGGGCTCTCAAACTGAAACCAAATCTCGAGATTTGGTTTCAGTTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145049.1-604s1c1
Sequence:CCGGCGGCCATATCTTCATGAATTTCTCGAGAAATTCATGAAGATATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145049.1-937s1c1
Sequence:CCGGGCGCACCTAAATCGTGATAAACTCGAGTTTATCACGATTTAGGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145049
VALIDATED
UBLCP1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like domain containing CTD phosphatase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145049.3-1287s21c1
Sequence:CCGGCAAGTTATACTGGCAGTTATTCTCGAGAATAACTGCCAGTATAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145049.3-1012s21c1
Sequence:CCGGTAAAGCCTCTTGGTGTTATATCTCGAGATATAACACCAAGAGGCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145049.3-1782s21c1
Sequence:CCGGACCTAGTTTGCTATGCTTAAACTCGAGTTTAAGCATAGCAAACTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145049.3-838s21c1
Sequence:CCGGCATCTGCCTATGAAGATTATGCTCGAGCATAATCTTCATAGGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145049.1-1744s1c1
Sequence:CCGGGCTGTGTCTTAGTATGAGAAACTCGAGTTTCTCATACTAAGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145049.1-475s1c1
Sequence:CCGGCGCAGAGTGAAAGAGTACAAACTCGAGTTTGTACTCTTTCACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145049.1-304s1c1
Sequence:CCGGGCTCTCAAACTGAAACCAAATCTCGAGATTTGGTTTCAGTTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145049.1-604s1c1
Sequence:CCGGCGGCCATATCTTCATGAATTTCTCGAGAAATTCATGAAGATATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145049.1-937s1c1
Sequence:CCGGGCGCACCTAAATCGTGATAAACTCGAGTTTATCACGATTTAGGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024475
VALIDATED
UBLCP1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like domain containing CTD phosphatase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024475.5-983s21c1
Sequence:CCGGAGCTCATCTAAACCGTGATAACTCGAGTTATCACGGTTTAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024475.5-762s21c1
Sequence:CCGGAGCACAAATGCCAACTATAAGCTCGAGCTTATAGTTGGCATTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024475.5-230s21c1
Sequence:CCGGTGATACTGTGCTGGATCTTAACTCGAGTTAAGATCCAGCACAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024475.5-1082s21c1
Sequence:CCGGGTACTGGGAGAGGTATCTATCCTCGAGGATAGATACCTCTCCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024475.5-1290s21c1
Sequence:CCGGTCTTCCCTCTATGTTAATTTACTCGAGTAAATTAACATAGAGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024475.3-1836s1c1
Sequence:CCGGGCAGCAAACATCTAGCCATAACTCGAGTTATGGCTAGATGTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024475.3-664s1c1
Sequence:CCGGGAGCACAAATGCCAACTATAACTCGAGTTATAGTTGGCATTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024475.3-887s1c1
Sequence:CCGGGCTCATCTAAACCGTGATAAACTCGAGTTTATCACGGTTTAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024475.3-193s1c1
Sequence:CCGGCCAGAAGTTACTAGGGCTCAACTCGAGTTGAGCCCTAGTAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024475.3-743s1c1
Sequence:CCGGCTCATTGACGTGAAGCCTCTTCTCGAGAAGAGGCTTCACGTCAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024475
VALIDATED
UBLCP1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like domain containing CTD phosphatase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024475.5-983s21c1
Sequence:CCGGAGCTCATCTAAACCGTGATAACTCGAGTTATCACGGTTTAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024475.5-762s21c1
Sequence:CCGGAGCACAAATGCCAACTATAAGCTCGAGCTTATAGTTGGCATTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024475.5-230s21c1
Sequence:CCGGTGATACTGTGCTGGATCTTAACTCGAGTTAAGATCCAGCACAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024475.5-1082s21c1
Sequence:CCGGGTACTGGGAGAGGTATCTATCCTCGAGGATAGATACCTCTCCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024475.5-1290s21c1
Sequence:CCGGTCTTCCCTCTATGTTAATTTACTCGAGTAAATTAACATAGAGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024475.3-1836s1c1
Sequence:CCGGGCAGCAAACATCTAGCCATAACTCGAGTTATGGCTAGATGTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024475.3-664s1c1
Sequence:CCGGGAGCACAAATGCCAACTATAACTCGAGTTATAGTTGGCATTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024475.3-887s1c1
Sequence:CCGGGCTCATCTAAACCGTGATAAACTCGAGTTTATCACGGTTTAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024475.3-193s1c1
Sequence:CCGGCCAGAAGTTACTAGGGCTCAACTCGAGTTGAGCCCTAGTAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024475.3-743s1c1
Sequence:CCGGCTCATTGACGTGAAGCCTCTTCTCGAGAAGAGGCTTCACGTCAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024475
VALIDATED
UBLCP1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like domain containing CTD phosphatase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024475.5-983s21c1
Sequence:CCGGAGCTCATCTAAACCGTGATAACTCGAGTTATCACGGTTTAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024475.5-762s21c1
Sequence:CCGGAGCACAAATGCCAACTATAAGCTCGAGCTTATAGTTGGCATTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024475.5-230s21c1
Sequence:CCGGTGATACTGTGCTGGATCTTAACTCGAGTTAAGATCCAGCACAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024475.5-1082s21c1
Sequence:CCGGGTACTGGGAGAGGTATCTATCCTCGAGGATAGATACCTCTCCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024475.5-1290s21c1
Sequence:CCGGTCTTCCCTCTATGTTAATTTACTCGAGTAAATTAACATAGAGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024475.3-1836s1c1
Sequence:CCGGGCAGCAAACATCTAGCCATAACTCGAGTTATGGCTAGATGTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024475.3-664s1c1
Sequence:CCGGGAGCACAAATGCCAACTATAACTCGAGTTATAGTTGGCATTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024475.3-887s1c1
Sequence:CCGGGCTCATCTAAACCGTGATAAACTCGAGTTTATCACGGTTTAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024475.3-193s1c1
Sequence:CCGGCCAGAAGTTACTAGGGCTCAACTCGAGTTGAGCCCTAGTAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024475.3-743s1c1
Sequence:CCGGCTCATTGACGTGAAGCCTCTTCTCGAGAAGAGGCTTCACGTCAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks