EMAIL THIS PAGE TO A FRIEND

UBN1

ubinuclein 1

Synonyms: VT VT4
UniProtKB ID: Q9NPG3, B7Z6D3, D3DUE8, Q13079, Q9P1P7
Gene ID:
Mouse(170644) ubinuclein 1
Rat(302935) ubinuclein 1
chicken(416398) ubinuclein 1
Horse(100066199) ubinuclein 1
dog(490022) ubinuclein 1
cow(525895) ubinuclein 1
sheep(101104289) ubinuclein 1
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026666 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026666 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026666 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016936 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079514 Rosetta Predictions human pricing
NM_016936 Rosetta Predictions human pricing
NM_001106977 Rosetta Predictions rat pricing
NM_026666 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313380 predicted 2363
2 SASI_Hs02_00313381 predicted 1473
3 SASI_Hs02_00313382 predicted 509
4 SASI_Hs02_00313383 predicted 3307
5 SASI_Hs02_00313384 predicted 3204
6 SASI_Hs02_00313385 predicted 3479
7 SASI_Hs02_00313386 predicted 2220
8 SASI_Hs02_00313387 predicted 1273
9 SASI_Hs02_00313388 predicted 1976
10 SASI_Hs02_00313389 predicted 1421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016617 predicted 2867
2 SASI_Hs01_00016618 predicted 1973
3 SASI_Hs01_00016620 predicted 3814
4 SASI_Hs02_00349926 predicted 3711
5 SASI_Hs01_00016621 predicted 3981
6 SASI_Hs01_00016622 predicted 2721
7 SASI_Hs01_00016623 predicted 1771
8 SASI_Hs01_00016625 predicted 1924
9 SASI_Hs02_00349927 predicted 2158
10 SASI_Hs02_00349928 predicted 3158
11 SASI_Hs01_00016616 predicted 2732
12 SASI_Hs01_00016619 predicted 885
13 SASI_Hs01_00016624 predicted 2339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106977 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224276 predicted 3888
2 SASI_Rn02_00224277 predicted 2493
3 SASI_Rn02_00224278 predicted 3320
4 SASI_Rn02_00224279 predicted 2300
5 SASI_Rn02_00224280 predicted 2778
6 SASI_Rn02_00224281 predicted 3203
7 SASI_Rn02_00224282 predicted 2464
8 SASI_Rn02_00224283 predicted 2367
9 SASI_Rn02_00224284 predicted 2563
10 SASI_Rn02_00224285 predicted 3852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192628 predicted 2133
2 SASI_Mm02_00330661 predicted 2006
3 SASI_Mm02_00330662 predicted 4317
4 SASI_Mm01_00192629 predicted 2662
5 SASI_Mm01_00192631 predicted 2087
6 SASI_Mm01_00192632 predicted 2318
7 SASI_Mm01_00192633 predicted 3989
8 SASI_Mm01_00192635 predicted 2063
9 SASI_Mm01_00192636 predicted 2011
10 SASI_Mm02_00330663 predicted 1018
11 SASI_Mm01_00192630 predicted 3191
12 SASI_Mm01_00192634 predicted 285
13 SASI_Mm01_00192637 predicted 1902
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026666
VALIDATED
UBN1 MISSION shRNA Bacterial Glycerol Stock
ubinuclein 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026666.1-163s1c1
Sequence:CCGGCGGATTACACTCACTCTCTTTCTCGAGAAAGAGAGTGAGTGTAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026666.1-2347s1c1
Sequence:CCGGCCTGAATTACACCCGTCCAAACTCGAGTTTGGACGGGTGTAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026666.1-2740s1c1
Sequence:CCGGGCTGGCTCAGTCTCTAAACATCTCGAGATGTTTAGAGACTGAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026666.1-5083s1c1
Sequence:CCGGGCCAAAGAAGAGATTTGTATACTCGAGTATACAAATCTCTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026666.1-1555s1c1
Sequence:CCGGCGGAAGAAATTCCAGTGGAATCTCGAGATTCCACTGGAATTTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026666.1-5256s1c1
Sequence:CCGGGCCCTCATCTTTAGGAATCTACTCGAGTAGATTCCTAAAGATGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026666.3-3580s21c1
Sequence:CCGGGCTGGCTCAGTCTCTAAACATCTCGAGATGTTTAGAGACTGAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026666.3-1003s21c1
Sequence:CCGGCGGATTACACTCACTCTCTTTCTCGAGAAAGAGAGTGAGTGTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026666.3-1669s1c1
Sequence:CCGGCCTGTAGCTGTGTCATCAATACTCGAGTATTGATGACACAGCTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026666.3-2395s21c1
Sequence:CCGGCGGAAGAAATTCCAGTGGAATCTCGAGATTCCACTGGAATTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026666.3-5923s21c1
Sequence:CCGGGCCAAAGAAGAGATTTGTATACTCGAGTATACAAATCTCTTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026666
VALIDATED
UBN1 MISSION shRNA shRNA Plasmid DNA
ubinuclein 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026666.1-163s1c1
Sequence:CCGGCGGATTACACTCACTCTCTTTCTCGAGAAAGAGAGTGAGTGTAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026666.1-2347s1c1
Sequence:CCGGCCTGAATTACACCCGTCCAAACTCGAGTTTGGACGGGTGTAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026666.1-2740s1c1
Sequence:CCGGGCTGGCTCAGTCTCTAAACATCTCGAGATGTTTAGAGACTGAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026666.1-5083s1c1
Sequence:CCGGGCCAAAGAAGAGATTTGTATACTCGAGTATACAAATCTCTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026666.1-1555s1c1
Sequence:CCGGCGGAAGAAATTCCAGTGGAATCTCGAGATTCCACTGGAATTTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026666.1-5256s1c1
Sequence:CCGGGCCCTCATCTTTAGGAATCTACTCGAGTAGATTCCTAAAGATGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026666.3-3580s21c1
Sequence:CCGGGCTGGCTCAGTCTCTAAACATCTCGAGATGTTTAGAGACTGAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026666.3-1003s21c1
Sequence:CCGGCGGATTACACTCACTCTCTTTCTCGAGAAAGAGAGTGAGTGTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026666.3-1669s1c1
Sequence:CCGGCCTGTAGCTGTGTCATCAATACTCGAGTATTGATGACACAGCTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026666.3-2395s21c1
Sequence:CCGGCGGAAGAAATTCCAGTGGAATCTCGAGATTCCACTGGAATTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026666.3-5923s21c1
Sequence:CCGGGCCAAAGAAGAGATTTGTATACTCGAGTATACAAATCTCTTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026666
VALIDATED
UBN1 MISSION shRNA Lentiviral Transduction Particles
ubinuclein 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026666.1-163s1c1
Sequence:CCGGCGGATTACACTCACTCTCTTTCTCGAGAAAGAGAGTGAGTGTAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026666.1-2347s1c1
Sequence:CCGGCCTGAATTACACCCGTCCAAACTCGAGTTTGGACGGGTGTAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026666.1-2740s1c1
Sequence:CCGGGCTGGCTCAGTCTCTAAACATCTCGAGATGTTTAGAGACTGAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026666.1-5083s1c1
Sequence:CCGGGCCAAAGAAGAGATTTGTATACTCGAGTATACAAATCTCTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026666.1-1555s1c1
Sequence:CCGGCGGAAGAAATTCCAGTGGAATCTCGAGATTCCACTGGAATTTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026666.1-5256s1c1
Sequence:CCGGGCCCTCATCTTTAGGAATCTACTCGAGTAGATTCCTAAAGATGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026666.3-3580s21c1
Sequence:CCGGGCTGGCTCAGTCTCTAAACATCTCGAGATGTTTAGAGACTGAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026666.3-1003s21c1
Sequence:CCGGCGGATTACACTCACTCTCTTTCTCGAGAAAGAGAGTGAGTGTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026666.3-1669s1c1
Sequence:CCGGCCTGTAGCTGTGTCATCAATACTCGAGTATTGATGACACAGCTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026666.3-2395s21c1
Sequence:CCGGCGGAAGAAATTCCAGTGGAATCTCGAGATTCCACTGGAATTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026666.3-5923s21c1
Sequence:CCGGGCCAAAGAAGAGATTTGTATACTCGAGTATACAAATCTCTTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016936
VALIDATED
UBN1 MISSION shRNA Bacterial Glycerol Stock
ubinuclein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016936.2-837s1c1
Sequence:CCGGCGGATTACACTCACCCTCTTTCTCGAGAAAGAGGGTGAGTGTAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016936.2-2229s1c1
Sequence:CCGGCGGAAGAAGTTCCAATGGAATCTCGAGATTCCATTGGAACTTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016936.2-3021s1c1
Sequence:CCGGCCAGAAGTACATCAGTCCAAACTCGAGTTTGGACTGATGTACTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_016936.2-3414s1c1
Sequence:CCGGGCCAGCTCAATCTCCAAACATCTCGAGATGTTTGGAGATTGAGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_016936.2-1986s1c1
Sequence:CCGGGCTCGGAAACTTCACCTCTATCTCGAGATAGAGGTGAAGTTTCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016936.3-2073s21c1
Sequence:CCGGTATGCCTATCTTGCGTCATTCCTCGAGGAATGACGCAAGATAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016936.3-1764s21c1
Sequence:CCGGATGGACTCGCTGACGGATTTGCTCGAGCAAATCCGTCAGCGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016936.3-1244s21c1
Sequence:CCGGATCCGACTCCTTCATCGATAACTCGAGTTATCGATGAAGGAGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016936.3-3907s21c1
Sequence:CCGGTGATGGCTTCACCCTACAAATCTCGAGATTTGTAGGGTGAAGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_016936.3-4756s21c1
Sequence:CCGGCTGCACTGTCCCTGCGAAATACTCGAGTATTTCGCAGGGACAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016936
VALIDATED
UBN1 MISSION shRNA shRNA Plasmid DNA
ubinuclein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016936.2-837s1c1
Sequence:CCGGCGGATTACACTCACCCTCTTTCTCGAGAAAGAGGGTGAGTGTAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016936.2-2229s1c1
Sequence:CCGGCGGAAGAAGTTCCAATGGAATCTCGAGATTCCATTGGAACTTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016936.2-3021s1c1
Sequence:CCGGCCAGAAGTACATCAGTCCAAACTCGAGTTTGGACTGATGTACTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_016936.2-3414s1c1
Sequence:CCGGGCCAGCTCAATCTCCAAACATCTCGAGATGTTTGGAGATTGAGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_016936.2-1986s1c1
Sequence:CCGGGCTCGGAAACTTCACCTCTATCTCGAGATAGAGGTGAAGTTTCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016936.3-2073s21c1
Sequence:CCGGTATGCCTATCTTGCGTCATTCCTCGAGGAATGACGCAAGATAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016936.3-1764s21c1
Sequence:CCGGATGGACTCGCTGACGGATTTGCTCGAGCAAATCCGTCAGCGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016936.3-1244s21c1
Sequence:CCGGATCCGACTCCTTCATCGATAACTCGAGTTATCGATGAAGGAGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016936.3-3907s21c1
Sequence:CCGGTGATGGCTTCACCCTACAAATCTCGAGATTTGTAGGGTGAAGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_016936.3-4756s21c1
Sequence:CCGGCTGCACTGTCCCTGCGAAATACTCGAGTATTTCGCAGGGACAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016936
VALIDATED
UBN1 MISSION shRNA Lentiviral Transduction Particles
ubinuclein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016936.2-837s1c1
Sequence:CCGGCGGATTACACTCACCCTCTTTCTCGAGAAAGAGGGTGAGTGTAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016936.2-2229s1c1
Sequence:CCGGCGGAAGAAGTTCCAATGGAATCTCGAGATTCCATTGGAACTTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016936.2-3021s1c1
Sequence:CCGGCCAGAAGTACATCAGTCCAAACTCGAGTTTGGACTGATGTACTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_016936.2-3414s1c1
Sequence:CCGGGCCAGCTCAATCTCCAAACATCTCGAGATGTTTGGAGATTGAGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_016936.2-1986s1c1
Sequence:CCGGGCTCGGAAACTTCACCTCTATCTCGAGATAGAGGTGAAGTTTCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016936.3-2073s21c1
Sequence:CCGGTATGCCTATCTTGCGTCATTCCTCGAGGAATGACGCAAGATAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016936.3-1764s21c1
Sequence:CCGGATGGACTCGCTGACGGATTTGCTCGAGCAAATCCGTCAGCGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016936.3-1244s21c1
Sequence:CCGGATCCGACTCCTTCATCGATAACTCGAGTTATCGATGAAGGAGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016936.3-3907s21c1
Sequence:CCGGTGATGGCTTCACCCTACAAATCTCGAGATTTGTAGGGTGAAGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_016936.3-4756s21c1
Sequence:CCGGCTGCACTGTCCCTGCGAAATACTCGAGTATTTCGCAGGGACAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks