EMAIL THIS PAGE TO A FRIEND

UBN2

ubinuclein 2

UniProtKB ID: Q6ZU65, A4D1S2, Q2YDY4, Q6P1K0, Q86XN9, Q8N7D1
Gene ID:
Mouse(320538) ubinuclein 2
Rat(312248) ubinuclein 2
cow(540792) ubinuclein 2
sheep(101110323) ubinuclein 2
Zebrafish(555525) ubinuclein 2
Horse(100066480) ubinuclein 2
dog(482776) ubinuclein 2
chicken(417970) ubinuclein 2
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177185 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177185 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177185 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173569 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_379933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_379933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_379933 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173569 Rosetta Predictions human pricing
XM_376679 Rosetta Predictions human pricing
NM_001134553 Rosetta Predictions rat pricing
NM_177185 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368400 predicted 2033
2 SASI_Hs02_00368401 predicted 3789
3 SASI_Hs02_00368402 predicted 2160
4 SASI_Hs02_00368403 predicted 1620
5 SASI_Hs02_00368404 predicted 2529
6 SASI_Hs02_00368405 predicted 1790
7 SASI_Hs02_00368406 predicted 3085
8 SASI_Hs02_00368407 predicted 1885
9 SASI_Hs02_00368408 predicted 3323
10 SASI_Hs02_00368409 predicted 1839
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257763 predicted 2267
2 SASI_Hs01_00257764 predicted 4016
3 SASI_Hs01_00257765 predicted 2386
4 SASI_Hs01_00257766 predicted 1844
5 SASI_Hs01_00257767 predicted 2747
6 SASI_Hs01_00257768 predicted 2007
7 SASI_Hs01_00257769 predicted 3309
8 SASI_Hs01_00257770 predicted 2114
9 SASI_Hs01_00257771 predicted 2562
10 SASI_Hs01_00257772 predicted 3543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257019 predicted 4201
2 SASI_Rn02_00257020 predicted 2683
3 SASI_Rn02_00257021 predicted 2031
4 SASI_Rn02_00257022 predicted 2209
5 SASI_Rn02_00257023 predicted 3002
6 SASI_Rn02_00257024 predicted 4160
7 SASI_Rn02_00257025 predicted 3792
8 SASI_Rn02_00257026 predicted 2941
9 SASI_Rn02_00257027 predicted 1767
10 SASI_Rn02_00257028 predicted 1576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021269 predicted 1774
2 SASI_Mm02_00347180 predicted 3448
3 SASI_Mm01_00021271 predicted 2898
4 SASI_Mm01_00021272 predicted 2208
5 SASI_Mm02_00347181 predicted 2516
6 SASI_Mm01_00021273 predicted 1578
7 SASI_Mm01_00021274 predicted 1782
8 SASI_Mm01_00021275 predicted 3754
9 SASI_Mm01_00021277 predicted 4165
10 SASI_Mm01_00021278 predicted 2739
11 SASI_Mm01_00021270 predicted 3337
12 SASI_Mm01_00021276 predicted 1627
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177185
VALIDATED
UBN2 MISSION shRNA Bacterial Glycerol Stock
ubinuclein 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-4121s21c1
Sequence:CCGGTCACTTACAGCAAGCGTTTAACTCGAGTTAAACGCTTGCTGTAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177185.4-4607s21c1
Sequence:CCGGCTCTACAGATAAGTGCATAATCTCGAGATTATGCACTTATCTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-2048s21c1
Sequence:CCGGTAACCTTGTTGAGATCAAATTCTCGAGAATTTGATCTCAACAAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-1663s21c1
Sequence:CCGGTTCTTCTGGACATCGAGTTACCTCGAGGTAACTCGATGTCCAGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-2193s21c1
Sequence:CCGGGAAAGCCGGAGTGTGCATAATCTCGAGATTATGCACACTCCGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-1023s21c1
Sequence:CCGGGAAGATGATATAGAGGTAAAGCTCGAGCTTTACCTCTATATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-1795s21c1
Sequence:CCGGATGTTCAGGATGATCGTTTAACTCGAGTTAAACGATCATCCTGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-3685s21c1
Sequence:CCGGTTAACTCAAGTGGAGCTAATACTCGAGTATTAGCTCCACTTGAGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177185.3-4242s1c1
Sequence:CCGGGCTGCTGTTTCTGTCCATGTTCTCGAGAACATGGACAGAAACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177185.3-2049s1c1
Sequence:CCGGGCTATGAATTAGAGCCAAATACTCGAGTATTTGGCTCTAATTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177185.3-4020s1c1
Sequence:CCGGCCCAGAATTTACTAAAGAGTTCTCGAGAACTCTTTAGTAAATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177185.3-1154s1c1
Sequence:CCGGGCTGCCATGATACGGAAATTTCTCGAGAAATTTCCGTATCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177185
VALIDATED
UBN2 MISSION shRNA shRNA Plasmid DNA
ubinuclein 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-4121s21c1
Sequence:CCGGTCACTTACAGCAAGCGTTTAACTCGAGTTAAACGCTTGCTGTAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177185.4-4607s21c1
Sequence:CCGGCTCTACAGATAAGTGCATAATCTCGAGATTATGCACTTATCTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-2048s21c1
Sequence:CCGGTAACCTTGTTGAGATCAAATTCTCGAGAATTTGATCTCAACAAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-1663s21c1
Sequence:CCGGTTCTTCTGGACATCGAGTTACCTCGAGGTAACTCGATGTCCAGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-2193s21c1
Sequence:CCGGGAAAGCCGGAGTGTGCATAATCTCGAGATTATGCACACTCCGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-1023s21c1
Sequence:CCGGGAAGATGATATAGAGGTAAAGCTCGAGCTTTACCTCTATATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-1795s21c1
Sequence:CCGGATGTTCAGGATGATCGTTTAACTCGAGTTAAACGATCATCCTGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-3685s21c1
Sequence:CCGGTTAACTCAAGTGGAGCTAATACTCGAGTATTAGCTCCACTTGAGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177185.3-4242s1c1
Sequence:CCGGGCTGCTGTTTCTGTCCATGTTCTCGAGAACATGGACAGAAACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177185.3-2049s1c1
Sequence:CCGGGCTATGAATTAGAGCCAAATACTCGAGTATTTGGCTCTAATTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177185.3-4020s1c1
Sequence:CCGGCCCAGAATTTACTAAAGAGTTCTCGAGAACTCTTTAGTAAATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177185.3-1154s1c1
Sequence:CCGGGCTGCCATGATACGGAAATTTCTCGAGAAATTTCCGTATCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177185
VALIDATED
UBN2 MISSION shRNA Lentiviral Transduction Particles
ubinuclein 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-4121s21c1
Sequence:CCGGTCACTTACAGCAAGCGTTTAACTCGAGTTAAACGCTTGCTGTAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177185.4-4607s21c1
Sequence:CCGGCTCTACAGATAAGTGCATAATCTCGAGATTATGCACTTATCTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-2048s21c1
Sequence:CCGGTAACCTTGTTGAGATCAAATTCTCGAGAATTTGATCTCAACAAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-1663s21c1
Sequence:CCGGTTCTTCTGGACATCGAGTTACCTCGAGGTAACTCGATGTCCAGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-2193s21c1
Sequence:CCGGGAAAGCCGGAGTGTGCATAATCTCGAGATTATGCACACTCCGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-1023s21c1
Sequence:CCGGGAAGATGATATAGAGGTAAAGCTCGAGCTTTACCTCTATATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-1795s21c1
Sequence:CCGGATGTTCAGGATGATCGTTTAACTCGAGTTAAACGATCATCCTGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177185.4-3685s21c1
Sequence:CCGGTTAACTCAAGTGGAGCTAATACTCGAGTATTAGCTCCACTTGAGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177185.3-4242s1c1
Sequence:CCGGGCTGCTGTTTCTGTCCATGTTCTCGAGAACATGGACAGAAACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177185.3-2049s1c1
Sequence:CCGGGCTATGAATTAGAGCCAAATACTCGAGTATTTGGCTCTAATTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177185.3-4020s1c1
Sequence:CCGGCCCAGAATTTACTAAAGAGTTCTCGAGAACTCTTTAGTAAATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177185.3-1154s1c1
Sequence:CCGGGCTGCCATGATACGGAAATTTCTCGAGAAATTTCCGTATCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173569
UBN2 MISSION shRNA Bacterial Glycerol Stock
ubinuclein 2
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000425705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173569.3-4275s21c1
Sequence:CCGGATGACAGAGTTACCGTATTAACTCGAGTTAATACGGTAACTCTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173569.3-3020s21c1
Sequence:CCGGCCACTACCTCCAGTAACTATTCTCGAGAATAGTTACTGGAGGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173569.3-1589s21c1
Sequence:CCGGATGTCCAGGATGATCGTTTAACTCGAGTTAAACGATCATCCTGGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173569
UBN2 MISSION shRNA shRNA Plasmid DNA
ubinuclein 2
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000425705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173569.3-4275s21c1
Sequence:CCGGATGACAGAGTTACCGTATTAACTCGAGTTAATACGGTAACTCTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173569.3-3020s21c1
Sequence:CCGGCCACTACCTCCAGTAACTATTCTCGAGAATAGTTACTGGAGGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173569.3-1589s21c1
Sequence:CCGGATGTCCAGGATGATCGTTTAACTCGAGTTAAACGATCATCCTGGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173569
UBN2 MISSION shRNA Lentiviral Transduction Particles
ubinuclein 2
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000425705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173569.3-4275s21c1
Sequence:CCGGATGACAGAGTTACCGTATTAACTCGAGTTAATACGGTAACTCTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173569.3-3020s21c1
Sequence:CCGGCCACTACCTCCAGTAACTATTCTCGAGAATAGTTACTGGAGGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173569.3-1589s21c1
Sequence:CCGGATGTCCAGGATGATCGTTTAACTCGAGTTAAACGATCATCCTGGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_379933
UBN2 MISSION shRNA Bacterial Glycerol Stock
ubinuclein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379933.1-2587s1c1
Sequence:CCGGGCCCAAGATGCTTCTTCGTTACTCGAGTAACGAAGAAGCATCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379933.1-430s1c1
Sequence:CCGGCGGCTACAAGATTTAATTGATCTCGAGATCAATTAAATCTTGTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379933.1-8390s1c1
Sequence:CCGGCCTTGTTTATTCCATTGCTTTCTCGAGAAAGCAATGGAATAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379933.1-1706s1c1
Sequence:CCGGGCTATGAGTTAGAACCAAATACTCGAGTATTTGGTTCTAACTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379933.1-6648s1c1
Sequence:CCGGCGTGTATTTCTGAAGAGCATTCTCGAGAATGCTCTTCAGAAATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_379933
UBN2 MISSION shRNA shRNA Plasmid DNA
ubinuclein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379933.1-2587s1c1
Sequence:CCGGGCCCAAGATGCTTCTTCGTTACTCGAGTAACGAAGAAGCATCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379933.1-430s1c1
Sequence:CCGGCGGCTACAAGATTTAATTGATCTCGAGATCAATTAAATCTTGTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379933.1-8390s1c1
Sequence:CCGGCCTTGTTTATTCCATTGCTTTCTCGAGAAAGCAATGGAATAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379933.1-1706s1c1
Sequence:CCGGGCTATGAGTTAGAACCAAATACTCGAGTATTTGGTTCTAACTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379933.1-6648s1c1
Sequence:CCGGCGTGTATTTCTGAAGAGCATTCTCGAGAATGCTCTTCAGAAATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_379933
UBN2 MISSION shRNA Lentiviral Transduction Particles
ubinuclein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379933.1-2587s1c1
Sequence:CCGGGCCCAAGATGCTTCTTCGTTACTCGAGTAACGAAGAAGCATCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379933.1-430s1c1
Sequence:CCGGCGGCTACAAGATTTAATTGATCTCGAGATCAATTAAATCTTGTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379933.1-8390s1c1
Sequence:CCGGCCTTGTTTATTCCATTGCTTTCTCGAGAAAGCAATGGAATAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379933.1-1706s1c1
Sequence:CCGGGCTATGAGTTAGAACCAAATACTCGAGTATTTGGTTCTAACTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379933.1-6648s1c1
Sequence:CCGGCGTGTATTTCTGAAGAGCATTCTCGAGAATGCTCTTCAGAAATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks