EMAIL THIS PAGE TO A FRIEND

UBOX5

U-box domain containing 5

Synonyms: RNF37 UBCE7IP5 UIP5
UniProtKB ID: O94941, Q6IAR5, Q86X87, Q9H4J2
Gene ID:
Human(22888) Summary: This gene encodes a U-box domain containing protein. The encoded protein interacts with E2 enzymes and may play a role in the ubiquitination pathway. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Mouse(140629) U box domain containing 5
Rat(296161) U-box domain containing 5
Zebrafish(402829) U-box domain containing 5
chicken(422940) U-box domain containing 5
dog(485799) U-box domain containing 5
Horse(100052706) U-box domain containing 5
domestic guinea pig(100719722) U-box domain containing 5
naked mole-rat(101718061) U-box domain containing 5
cow(514445) U-box domain containing 5
sheep(101123317) U-box domain containing 5
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080562 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080562 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080562 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014948 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014948 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014948 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014948 Rosetta Predictions human pricing
NM_199415 Rosetta Predictions human pricing
NM_001033997 Rosetta Predictions rat pricing
NM_080562 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145159 predicted 512
2 SASI_Hs01_00145160 predicted 283
3 SASI_Hs01_00145161 predicted 674
4 SASI_Hs01_00145162 predicted 345
5 SASI_Hs02_00346622 predicted 1974
6 SASI_Hs01_00145163 predicted 333
7 SASI_Hs02_00346623 predicted 809
8 SASI_Hs01_00145168 predicted 283
9 SASI_Hs02_00346624 predicted 251
10 SASI_Hs02_00346625 predicted 294
11 SASI_Hs01_00145164 predicted 974
12 SASI_Hs01_00145165 predicted 328
13 SASI_Hs01_00145166 predicted 209
14 SASI_Hs01_00145167 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168012 predicted 514
2 SASI_Hs01_00168013 predicted 285
3 SASI_Hs01_00168015 predicted 676
4 SASI_Hs01_00168016 predicted 342
5 SASI_Hs01_00168017 predicted 1809
6 SASI_Hs01_00168018 predicted 330
7 SASI_Hs02_00372811 predicted 802
8 SASI_Hs01_00168021 predicted 279
9 SASI_Hs02_00372812 predicted 247
10 SASI_Hs02_00372813 predicted 299
11 SASI_Hs01_00168014 predicted 200
12 SASI_Hs01_00168019 predicted 322
13 SASI_Hs01_00168020 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203869 predicted 641
2 SASI_Rn02_00203870 predicted 328
3 SASI_Rn01_00065002 predicted 1414
4 SASI_Rn01_00065003 predicted 1914
5 SASI_Rn01_00065004 predicted 415
6 SASI_Rn01_00065005 predicted 1476
7 SASI_Rn01_00065006 predicted 348
8 SASI_Rn01_00065007 predicted 1234
9 SASI_Rn01_00065009 predicted 1500
10 SASI_Rn01_00065010 predicted 906
11 SASI_Rn01_00065008 predicted 1096
12 SASI_Rn01_00065011 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080562 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028890 predicted 1430
2 SASI_Mm01_00028892 predicted 1243
3 SASI_Mm01_00028893 predicted 375
4 SASI_Mm01_00028894 predicted 289
5 SASI_Mm01_00028895 predicted 1880
6 SASI_Mm02_00338170 predicted 342
7 SASI_Mm01_00028897 predicted 447
8 SASI_Mm02_00338171 predicted 1121
9 SASI_Mm01_00028899 predicted 512
10 SASI_Mm02_00338172 predicted 1366
11 SASI_Mm01_00028891 predicted 1372
12 SASI_Mm01_00028896 predicted 306
13 SASI_Mm01_00028898 predicted 1871
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080562
UBOX5 MISSION shRNA Bacterial Glycerol Stock
U-box domain containing 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080562.2-1410s1c1
Sequence:CCGGCTCTGCCACAAGCCCTTTATTCTCGAGAATAAAGGGCTTGTGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080562.2-2411s1c1
Sequence:CCGGCGGATAAGCAAGGGTTCAGATCTCGAGATCTGAACCCTTGCTTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080562.2-433s1c1
Sequence:CCGGCCCTTTAATGTGGAAATCTGTCTCGAGACAGATTTCCACATTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080562.2-406s1c1
Sequence:CCGGCCTCCAATCTATGTGACAGTTCTCGAGAACTGTCACATAGATTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080562.4-1409s21c1
Sequence:CCGGCTCTGCCACAAGCCCTTTATTCTCGAGAATAAAGGGCTTGTGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080562.4-397s21c1
Sequence:CCGGTCATTAGACCTCCAATCTATGCTCGAGCATAGATTGGAGGTCTAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080562.4-442s21c1
Sequence:CCGGTGGAAATCTGTAGGGTTAATACTCGAGTATTAACCCTACAGATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080562.4-2031s21c1
Sequence:CCGGAGGCAACAACAGGATAATAAACTCGAGTTTATTATCCTGTTGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080562.4-1253s21c1
Sequence:CCGGCCTACTCCAGCACTCTATTTCCTCGAGGAAATAGAGTGCTGGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080562
UBOX5 MISSION shRNA shRNA Plasmid DNA
U-box domain containing 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080562.2-1410s1c1
Sequence:CCGGCTCTGCCACAAGCCCTTTATTCTCGAGAATAAAGGGCTTGTGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080562.2-2411s1c1
Sequence:CCGGCGGATAAGCAAGGGTTCAGATCTCGAGATCTGAACCCTTGCTTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080562.2-433s1c1
Sequence:CCGGCCCTTTAATGTGGAAATCTGTCTCGAGACAGATTTCCACATTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080562.2-406s1c1
Sequence:CCGGCCTCCAATCTATGTGACAGTTCTCGAGAACTGTCACATAGATTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080562.4-1409s21c1
Sequence:CCGGCTCTGCCACAAGCCCTTTATTCTCGAGAATAAAGGGCTTGTGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080562.4-397s21c1
Sequence:CCGGTCATTAGACCTCCAATCTATGCTCGAGCATAGATTGGAGGTCTAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080562.4-442s21c1
Sequence:CCGGTGGAAATCTGTAGGGTTAATACTCGAGTATTAACCCTACAGATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080562.4-2031s21c1
Sequence:CCGGAGGCAACAACAGGATAATAAACTCGAGTTTATTATCCTGTTGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080562.4-1253s21c1
Sequence:CCGGCCTACTCCAGCACTCTATTTCCTCGAGGAAATAGAGTGCTGGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080562
UBOX5 MISSION shRNA Lentiviral Transduction Particles
U-box domain containing 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080562.2-1410s1c1
Sequence:CCGGCTCTGCCACAAGCCCTTTATTCTCGAGAATAAAGGGCTTGTGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080562.2-2411s1c1
Sequence:CCGGCGGATAAGCAAGGGTTCAGATCTCGAGATCTGAACCCTTGCTTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080562.2-433s1c1
Sequence:CCGGCCCTTTAATGTGGAAATCTGTCTCGAGACAGATTTCCACATTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080562.2-406s1c1
Sequence:CCGGCCTCCAATCTATGTGACAGTTCTCGAGAACTGTCACATAGATTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080562.4-1409s21c1
Sequence:CCGGCTCTGCCACAAGCCCTTTATTCTCGAGAATAAAGGGCTTGTGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080562.4-397s21c1
Sequence:CCGGTCATTAGACCTCCAATCTATGCTCGAGCATAGATTGGAGGTCTAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080562.4-442s21c1
Sequence:CCGGTGGAAATCTGTAGGGTTAATACTCGAGTATTAACCCTACAGATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080562.4-2031s21c1
Sequence:CCGGAGGCAACAACAGGATAATAAACTCGAGTTTATTATCCTGTTGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080562.4-1253s21c1
Sequence:CCGGCCTACTCCAGCACTCTATTTCCTCGAGGAAATAGAGTGCTGGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014948
VALIDATED
UBOX5 MISSION shRNA Bacterial Glycerol Stock
U-box domain containing 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014948.x-1022s1c1
Sequence:CCGGGAGAAGTGTAACCGCAGTGAACTCGAGTTCACTGCGGTTACACTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014948.x-2850s1c1
Sequence:CCGGCCGGCACATTCCTTTCCTTTACTCGAGTAAAGGAAAGGAATGTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014948.x-268s1c1
Sequence:CCGGTCATGGTTTCAGGACAGAGTACTCGAGTACTCTGTCCTGAAACCATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014948.x-1200s1c1
Sequence:CCGGCATTGGCAGTGATCCCTTCTTCTCGAGAAGAAGGGATCACTGCCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014948.x-700s1c1
Sequence:CCGGCGGCGGTATCCCTTGTATCAACTCGAGTTGATACAAGGGATACCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014948.2-1290s21c1
Sequence:CCGGGACAGTAACTTTGGTGTAAATCTCGAGATTTACACCAAAGTTACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014948.2-398s21c1
Sequence:CCGGGAACGTCACTGGCCTGGAAATCTCGAGATTTCCAGGCCAGTGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014948.2-330s21c1
Sequence:CCGGACAGTTTCATTTCCCTTTAATCTCGAGATTAAAGGGAAATGAAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014948
VALIDATED
UBOX5 MISSION shRNA shRNA Plasmid DNA
U-box domain containing 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014948.x-1022s1c1
Sequence:CCGGGAGAAGTGTAACCGCAGTGAACTCGAGTTCACTGCGGTTACACTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014948.x-2850s1c1
Sequence:CCGGCCGGCACATTCCTTTCCTTTACTCGAGTAAAGGAAAGGAATGTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014948.x-268s1c1
Sequence:CCGGTCATGGTTTCAGGACAGAGTACTCGAGTACTCTGTCCTGAAACCATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014948.x-1200s1c1
Sequence:CCGGCATTGGCAGTGATCCCTTCTTCTCGAGAAGAAGGGATCACTGCCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014948.x-700s1c1
Sequence:CCGGCGGCGGTATCCCTTGTATCAACTCGAGTTGATACAAGGGATACCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014948.2-1290s21c1
Sequence:CCGGGACAGTAACTTTGGTGTAAATCTCGAGATTTACACCAAAGTTACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014948.2-398s21c1
Sequence:CCGGGAACGTCACTGGCCTGGAAATCTCGAGATTTCCAGGCCAGTGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014948.2-330s21c1
Sequence:CCGGACAGTTTCATTTCCCTTTAATCTCGAGATTAAAGGGAAATGAAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014948
VALIDATED
UBOX5 MISSION shRNA Lentiviral Transduction Particles
U-box domain containing 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014948.x-1022s1c1
Sequence:CCGGGAGAAGTGTAACCGCAGTGAACTCGAGTTCACTGCGGTTACACTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014948.x-2850s1c1
Sequence:CCGGCCGGCACATTCCTTTCCTTTACTCGAGTAAAGGAAAGGAATGTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014948.x-268s1c1
Sequence:CCGGTCATGGTTTCAGGACAGAGTACTCGAGTACTCTGTCCTGAAACCATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014948.x-1200s1c1
Sequence:CCGGCATTGGCAGTGATCCCTTCTTCTCGAGAAGAAGGGATCACTGCCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014948.x-700s1c1
Sequence:CCGGCGGCGGTATCCCTTGTATCAACTCGAGTTGATACAAGGGATACCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014948.2-1290s21c1
Sequence:CCGGGACAGTAACTTTGGTGTAAATCTCGAGATTTACACCAAAGTTACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014948.2-398s21c1
Sequence:CCGGGAACGTCACTGGCCTGGAAATCTCGAGATTTCCAGGCCAGTGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014948.2-330s21c1
Sequence:CCGGACAGTTTCATTTCCCTTTAATCTCGAGATTAAAGGGAAATGAAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks