EMAIL THIS PAGE TO A FRIEND

UBP1

upstream binding protein 1 (LBP-1a)

Synonyms: LBP-1B LBP-1a LBP1A LBP1B
UniProtKB ID: Q9NZI7, Q68CT0, Q86Y57, Q9H8V0, Q9UD76, Q9UD78
Gene ID:
Mouse(22221) upstream binding protein 1
Rat(301038) upstream binding protein 1 (LBP-1a)
Thale Cress(817839) ubiquitin carboxyl-terminal hydrolase 1
chicken(428458) upstream binding protein 1 (LBP-1a)
domestic cat(101097512) upstream binding protein 1 (LBP-1a)
dog(485572) upstream binding protein 1 (LBP-1a)
Zebrafish(100136855) upstream binding protein 1 (LBP-1a)
cow(785419) upstream binding protein 1 (LBP-1a)
sheep(101105857) upstream binding protein 1 (LBP-1a)
naked mole-rat(101714569) upstream binding protein 1 (LBP-1a)
domestic guinea pig(100719434) upstream binding protein 1 (LBP-1a)
175 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013699 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013699 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013699 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014517 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014517 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014517 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128160 Rosetta Predictions human pricing
NM_001128161 Rosetta Predictions human pricing
NM_014517 Rosetta Predictions human pricing
XM_001076644 Rosetta Predictions rat pricing
XM_238562 Rosetta Predictions rat pricing
NM_001083319 Rosetta Predictions mouse pricing
NM_013699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330626 predicted 1025
2 SASI_Hs02_00330627 predicted 2055
3 SASI_Hs02_00330628 predicted 1011
4 SASI_Hs02_00330629 predicted 2044
5 SASI_Hs02_00330630 predicted 638
6 SASI_Hs02_00330631 predicted 2096
7 SASI_Hs02_00330632 predicted 2133
8 SASI_Hs02_00330633 predicted 763
9 SASI_Hs02_00330634 predicted 629
10 SASI_Hs02_00330635 predicted 2063
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330636 predicted 1378
2 SASI_Hs02_00330637 predicted 1780
3 SASI_Hs02_00330638 predicted 627
4 SASI_Hs02_00330639 predicted 1769
5 SASI_Hs02_00330640 predicted 255
6 SASI_Hs02_00330641 predicted 1823
7 SASI_Hs02_00330642 predicted 1858
8 SASI_Hs02_00330643 predicted 1407
9 SASI_Hs02_00330644 predicted 249
10 SASI_Hs02_00330645 predicted 1342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121697 predicted 1757
2 SASI_Hs01_00121700 predicted 1004
3 SASI_Hs01_00121701 predicted 2151
4 SASI_Hs02_00345792 predicted 636
5 SASI_Hs01_00121702 predicted 2196
6 SASI_Hs02_00345793 predicted 2241
7 SASI_Hs01_00121703 predicted 1137
8 SASI_Hs01_00121704 predicted 1779
9 SASI_Hs01_00121706 predicted 622
10 SASI_Hs02_00345794 predicted 1724
11 SASI_Hs01_00121698 predicted 1816
12 SASI_Hs01_00121699 predicted 2160
13 SASI_Hs01_00121705 predicted 1733
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076644 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353992 predicted 760
2 SASI_Rn02_00353993 predicted 1720
3 SASI_Rn02_00353994 predicted 1895
4 SASI_Rn02_00353995 predicted 1862
5 SASI_Rn02_00353996 predicted 1418
6 SASI_Rn02_00353997 predicted 681
7 SASI_Rn02_00353998 predicted 324
8 SASI_Rn02_00353999 predicted 1687
9 SASI_Rn02_00354000 predicted 1587
10 SASI_Rn02_00354001 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238562 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391426 predicted 2132
2 SASI_Rn02_00391427 predicted 2208
3 SASI_Rn02_00391428 predicted 2243
4 SASI_Rn02_00391429 predicted 2312
5 SASI_Rn02_00391430 predicted 2262
6 SASI_Rn02_00391431 predicted 1833
7 SASI_Rn02_00391432 predicted 1085
8 SASI_Rn02_00391433 predicted 728
9 SASI_Rn02_00391434 predicted 2093
10 SASI_Rn02_00391435 predicted 1997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299611 predicted 594
2 SASI_Mm02_00299612 predicted 649
3 SASI_Mm02_00299613 predicted 517
4 SASI_Mm02_00299614 predicted 1914
5 SASI_Mm02_00299615 predicted 1644
6 SASI_Mm02_00299616 predicted 754
7 SASI_Mm02_00299617 predicted 1611
8 SASI_Mm02_00299618 predicted 2001
9 SASI_Mm02_00299619 predicted 1668
10 SASI_Mm02_00299620 predicted 1936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322592 predicted 593
2 SASI_Mm01_00125791 predicted 649
3 SASI_Mm02_00322593 predicted 522
4 SASI_Mm01_00125794 predicted 1802
5 SASI_Mm02_00322594 predicted 1542
6 SASI_Mm02_00322595 predicted 750
7 SASI_Mm01_00125795 predicted 1507
8 SASI_Mm01_00125796 predicted 1895
9 SASI_Mm01_00125798 predicted 1560
10 SASI_Mm02_00322596 predicted 1830
11 SASI_Mm01_00125789 predicted 1609
12 SASI_Mm01_00125790 predicted 1532
13 SASI_Mm01_00125792 predicted 1509
14 SASI_Mm01_00125793 predicted 389
15 SASI_Mm01_00125797 predicted 1520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013699
VALIDATED
UBP1 MISSION shRNA Bacterial Glycerol Stock
upstream binding protein 1 (LBP-1a)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013699.2-1804s21c1
Sequence:CCGGCCCACTGGTATCCACATTCTTCTCGAGAAGAATGTGGATACCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013699.2-1539s21c1
Sequence:CCGGCGATGGAATTCGGCTCTATAACTCGAGTTATAGAGCCGAATTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013699.2-1936s21c1
Sequence:CCGGCGGACTGAACTCTATCCAGTACTCGAGTACTGGATAGAGTTCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013699.2-1686s21c1
Sequence:CCGGGCCCTCCGTTTATCATGCAATCTCGAGATTGCATGATAAACGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013699.1-1527s1c1
Sequence:CCGGCGGACTGAACTCTATCCAGTACTCGAGTACTGGATAGAGTTCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013699.1-1277s1c1
Sequence:CCGGGCCCTCCGTTTATCATGCAATCTCGAGATTGCATGATAAACGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013699.1-1130s1c1
Sequence:CCGGCGATGGAATTCGGCTCTATAACTCGAGTTATAGAGCCGAATTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013699.1-1395s1c1
Sequence:CCGGCCCACTGGTATCCACATTCTTCTCGAGAAGAATGTGGATACCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013699.1-1079s1c1
Sequence:CCGGCGACTTATTAAAGCTGACAAACTCGAGTTTGTCAGCTTTAATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013699
VALIDATED
UBP1 MISSION shRNA shRNA Plasmid DNA
upstream binding protein 1 (LBP-1a)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013699.2-1804s21c1
Sequence:CCGGCCCACTGGTATCCACATTCTTCTCGAGAAGAATGTGGATACCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013699.2-1539s21c1
Sequence:CCGGCGATGGAATTCGGCTCTATAACTCGAGTTATAGAGCCGAATTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013699.2-1936s21c1
Sequence:CCGGCGGACTGAACTCTATCCAGTACTCGAGTACTGGATAGAGTTCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013699.2-1686s21c1
Sequence:CCGGGCCCTCCGTTTATCATGCAATCTCGAGATTGCATGATAAACGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013699.1-1527s1c1
Sequence:CCGGCGGACTGAACTCTATCCAGTACTCGAGTACTGGATAGAGTTCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013699.1-1277s1c1
Sequence:CCGGGCCCTCCGTTTATCATGCAATCTCGAGATTGCATGATAAACGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013699.1-1130s1c1
Sequence:CCGGCGATGGAATTCGGCTCTATAACTCGAGTTATAGAGCCGAATTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013699.1-1395s1c1
Sequence:CCGGCCCACTGGTATCCACATTCTTCTCGAGAAGAATGTGGATACCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013699.1-1079s1c1
Sequence:CCGGCGACTTATTAAAGCTGACAAACTCGAGTTTGTCAGCTTTAATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013699
VALIDATED
UBP1 MISSION shRNA Lentiviral Transduction Particles
upstream binding protein 1 (LBP-1a)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013699.2-1804s21c1
Sequence:CCGGCCCACTGGTATCCACATTCTTCTCGAGAAGAATGTGGATACCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013699.2-1539s21c1
Sequence:CCGGCGATGGAATTCGGCTCTATAACTCGAGTTATAGAGCCGAATTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013699.2-1936s21c1
Sequence:CCGGCGGACTGAACTCTATCCAGTACTCGAGTACTGGATAGAGTTCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013699.2-1686s21c1
Sequence:CCGGGCCCTCCGTTTATCATGCAATCTCGAGATTGCATGATAAACGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013699.1-1527s1c1
Sequence:CCGGCGGACTGAACTCTATCCAGTACTCGAGTACTGGATAGAGTTCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013699.1-1277s1c1
Sequence:CCGGGCCCTCCGTTTATCATGCAATCTCGAGATTGCATGATAAACGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013699.1-1130s1c1
Sequence:CCGGCGATGGAATTCGGCTCTATAACTCGAGTTATAGAGCCGAATTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013699.1-1395s1c1
Sequence:CCGGCCCACTGGTATCCACATTCTTCTCGAGAAGAATGTGGATACCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013699.1-1079s1c1
Sequence:CCGGCGACTTATTAAAGCTGACAAACTCGAGTTTGTCAGCTTTAATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014517
VALIDATED
UBP1 MISSION shRNA Bacterial Glycerol Stock
upstream binding protein 1 (LBP-1a)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014517.4-1024s21c1
Sequence:CCGGGCCAGTTAAATGCGGTTGAATCTCGAGATTCAACCGCATTTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014517.4-2672s21c1
Sequence:CCGGCGGCACCTTCTTGGAAGAAATCTCGAGATTTCTTCCAAGAAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014517.4-2000s21c1
Sequence:CCGGCCACCAAATTAATCAGGTTTACTCGAGTAAACCTGATTAATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014517.4-764s21c1
Sequence:CCGGGCATGATGAAACGCTTACTTACTCGAGTAAGTAAGCGTTTCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014517.4-903s21c1
Sequence:CCGGCGGCTACAATACACAGAGCATCTCGAGATGCTCTGTGTATTGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014517.2-2671s1c1
Sequence:CCGGCGGCACCTTCTTGGAAGAAATCTCGAGATTTCTTCCAAGAAGGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014517.2-902s1c1
Sequence:CCGGCGGCTACAATACACAGAGCATCTCGAGATGCTCTGTGTATTGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014517.2-763s1c1
Sequence:CCGGGCATGATGAAACGCTTACTTACTCGAGTAAGTAAGCGTTTCATCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014517.2-1999s1c1
Sequence:CCGGCCACCAAATTAATCAGGTTTACTCGAGTAAACCTGATTAATTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014517
VALIDATED
UBP1 MISSION shRNA shRNA Plasmid DNA
upstream binding protein 1 (LBP-1a)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014517.4-1024s21c1
Sequence:CCGGGCCAGTTAAATGCGGTTGAATCTCGAGATTCAACCGCATTTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014517.4-2672s21c1
Sequence:CCGGCGGCACCTTCTTGGAAGAAATCTCGAGATTTCTTCCAAGAAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014517.4-2000s21c1
Sequence:CCGGCCACCAAATTAATCAGGTTTACTCGAGTAAACCTGATTAATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014517.4-764s21c1
Sequence:CCGGGCATGATGAAACGCTTACTTACTCGAGTAAGTAAGCGTTTCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014517.4-903s21c1
Sequence:CCGGCGGCTACAATACACAGAGCATCTCGAGATGCTCTGTGTATTGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014517.2-2671s1c1
Sequence:CCGGCGGCACCTTCTTGGAAGAAATCTCGAGATTTCTTCCAAGAAGGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014517.2-902s1c1
Sequence:CCGGCGGCTACAATACACAGAGCATCTCGAGATGCTCTGTGTATTGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014517.2-763s1c1
Sequence:CCGGGCATGATGAAACGCTTACTTACTCGAGTAAGTAAGCGTTTCATCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014517.2-1999s1c1
Sequence:CCGGCCACCAAATTAATCAGGTTTACTCGAGTAAACCTGATTAATTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014517
VALIDATED
UBP1 MISSION shRNA Lentiviral Transduction Particles
upstream binding protein 1 (LBP-1a)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014517.4-1024s21c1
Sequence:CCGGGCCAGTTAAATGCGGTTGAATCTCGAGATTCAACCGCATTTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014517.4-2672s21c1
Sequence:CCGGCGGCACCTTCTTGGAAGAAATCTCGAGATTTCTTCCAAGAAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014517.4-2000s21c1
Sequence:CCGGCCACCAAATTAATCAGGTTTACTCGAGTAAACCTGATTAATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014517.4-764s21c1
Sequence:CCGGGCATGATGAAACGCTTACTTACTCGAGTAAGTAAGCGTTTCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014517.4-903s21c1
Sequence:CCGGCGGCTACAATACACAGAGCATCTCGAGATGCTCTGTGTATTGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014517.2-2671s1c1
Sequence:CCGGCGGCACCTTCTTGGAAGAAATCTCGAGATTTCTTCCAAGAAGGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014517.2-902s1c1
Sequence:CCGGCGGCTACAATACACAGAGCATCTCGAGATGCTCTGTGTATTGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014517.2-763s1c1
Sequence:CCGGGCATGATGAAACGCTTACTTACTCGAGTAAGTAAGCGTTTCATCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014517.2-1999s1c1
Sequence:CCGGCCACCAAATTAATCAGGTTTACTCGAGTAAACCTGATTAATTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks