EMAIL THIS PAGE TO A FRIEND

UBQLN1

ubiquilin 1

Synonyms: DA41 DSK2 PLIC-1 UBQN XDRP1
Gene ID:
Human(29979) Summary: This gene encodes an ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and thus are thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This ubiquilin has also been shown to modulate accumulation of presenilin proteins, and it is found in lesions associated with Alzheimer's and Parkinson's disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(56085) ubiquilin 1
Rat(114590) ubiquilin 1
chicken(427454) ubiquilin 1
Horse(100052573) ubiquilin 1
dog(476312) ubiquilin 1
cow(282392) ubiquilin 1
sheep(100302096) ubiquilin 1
180 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
U7383 Anti-Ubiquilin-1 (N-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse, rat
western blot pricing
U7258 Anti-Ubiquilin-1 antibody produced in rabbit ~0.5 mg/mL, affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1306678 ANTI-UBIQUILIN1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1306684 ANTI-UBIQUILIN1 (PLIC1)(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB1305680 ANTI-UBIQUILIN1(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB2102632 Anti-UBQLN1 antibody produced in rabbit affinity isolated antibody rabbit, bovine, rat, zebrafish, human, guinea pig, canine, mouse, sheep, horse
western blot pricing
HPA054143 Anti-UBQLN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
WH0029979M1 Monoclonal Anti-UBQLN1 antibody produced in mouse clone 1C6-A3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1405058 Monoclonal Anti-UBQLN1 antibody produced in mouse clone 1C6-B7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026842 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026842 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026842 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013438 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013438 Rosetta Predictions human pricing
NM_053067 Rosetta Predictions human pricing
NM_053747 Rosetta Predictions rat pricing
NM_026842 Rosetta Predictions mouse pricing
NM_152234 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157571 predicted 899
2 SASI_Hs01_00157572 predicted 873
3 SASI_Hs01_00157573 predicted 647
4 SASI_Hs01_00157574 predicted 2162
5 SASI_Hs01_00157576 predicted 2049
6 SASI_Hs01_00157577 predicted 1121
7 SASI_Hs01_00157578 predicted 1021
8 SASI_Hs02_00344840 predicted 638
9 SASI_Hs02_00344841 predicted 1036
10 SASI_Hs01_00157580 predicted 740
11 SASI_Hs01_00157575 predicted 1183
12 SASI_Hs01_00157579 predicted 2213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143330 predicted 816
2 SASI_Hs01_00143331 predicted 785
3 SASI_Hs01_00143332 predicted 560
4 SASI_Hs01_00143333 predicted 1989
5 SASI_Hs01_00143335 predicted 1880
6 SASI_Hs01_00143336 predicted 1035
7 SASI_Hs01_00143337 predicted 935
8 SASI_Hs02_00361904 predicted 551
9 SASI_Hs02_00361905 predicted 950
10 SASI_Hs01_00143339 predicted 658
11 SASI_Hs01_00143334 predicted 1099
12 SASI_Hs01_00143338 predicted 2044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061212 predicted 841
2 SASI_Rn01_00061213 predicted 1908
3 SASI_Rn01_00061214 predicted 433
4 SASI_Rn01_00061215 predicted 598
5 SASI_Rn01_00061216 predicted 653
6 SASI_Rn01_00061217 predicted 683
7 SASI_Rn01_00061218 predicted 1020
8 SASI_Rn01_00061219 predicted 631
9 SASI_Rn01_00061220 predicted 822
10 SASI_Rn02_00266531 predicted 609
11 SASI_Rn01_00061221 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026842 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139777 predicted 746
2 SASI_Mm01_00139778 predicted 212
3 SASI_Mm01_00139779 predicted 196
4 SASI_Mm01_00139780 predicted 655
5 SASI_Mm02_00331034 predicted 209
6 SASI_Mm01_00139781 predicted 1050
7 SASI_Mm01_00139782 predicted 1140
8 SASI_Mm01_00139784 predicted 547
9 SASI_Mm01_00139785 predicted 1103
10 SASI_Mm01_00139786 predicted 1108
11 SASI_Mm01_00139783 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152234 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171309 predicted 1009
2 SASI_Mm01_00171310 predicted 669
3 SASI_Mm01_00171311 predicted 991
4 SASI_Mm01_00171312 predicted 646
5 SASI_Mm01_00171313 predicted 957
6 SASI_Mm01_00171314 predicted 1811
7 SASI_Mm01_00171315 predicted 422
8 SASI_Mm01_00171316 predicted 988
9 SASI_Mm01_00171317 predicted 314
10 SASI_Mm02_00342796 predicted 968
11 SASI_Mm01_00171318 predicted 1915
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026842
VALIDATED
UBQLN1 MISSION shRNA Bacterial Glycerol Stock
ubiquilin 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026842.3-526s1c1
Sequence:CCGGCCAGAAGTCAGATTTCAGCAACTCGAGTTGCTGAAATCTGACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026842.3-519s1c1
Sequence:CCGGGCAGAGTCCAGAAGTCAGATTCTCGAGAATCTGACTTCTGGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026842.3-1528s1c1
Sequence:CCGGCGGTTCTAATTGCCATATAAACTCGAGTTTATATGGCAATTAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026842.3-410s1c1
Sequence:CCGGGCACTGCACCTAGTGAAGATACTCGAGTATCTTCACTAGGTGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026842.3-623s1c1
Sequence:CCGGACATCAATGCAGCAATCGAAACTCGAGTTTCGATTGCTGCATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026842.3-519s21c1
Sequence:CCGGGCAGAGTCCAGAAGTCAGATTCTCGAGAATCTGACTTCTGGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026842.3-1528s21c1
Sequence:CCGGCGGTTCTAATTGCCATATAAACTCGAGTTTATATGGCAATTAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026842.3-410s21c1
Sequence:CCGGGCACTGCACCTAGTGAAGATACTCGAGTATCTTCACTAGGTGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026842.3-623s21c1
Sequence:CCGGACATCAATGCAGCAATCGAAACTCGAGTTTCGATTGCTGCATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026842
VALIDATED
UBQLN1 MISSION shRNA shRNA Plasmid DNA
ubiquilin 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026842.3-526s1c1
Sequence:CCGGCCAGAAGTCAGATTTCAGCAACTCGAGTTGCTGAAATCTGACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026842.3-519s1c1
Sequence:CCGGGCAGAGTCCAGAAGTCAGATTCTCGAGAATCTGACTTCTGGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026842.3-1528s1c1
Sequence:CCGGCGGTTCTAATTGCCATATAAACTCGAGTTTATATGGCAATTAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026842.3-410s1c1
Sequence:CCGGGCACTGCACCTAGTGAAGATACTCGAGTATCTTCACTAGGTGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026842.3-623s1c1
Sequence:CCGGACATCAATGCAGCAATCGAAACTCGAGTTTCGATTGCTGCATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026842.3-519s21c1
Sequence:CCGGGCAGAGTCCAGAAGTCAGATTCTCGAGAATCTGACTTCTGGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026842.3-1528s21c1
Sequence:CCGGCGGTTCTAATTGCCATATAAACTCGAGTTTATATGGCAATTAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026842.3-410s21c1
Sequence:CCGGGCACTGCACCTAGTGAAGATACTCGAGTATCTTCACTAGGTGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026842.3-623s21c1
Sequence:CCGGACATCAATGCAGCAATCGAAACTCGAGTTTCGATTGCTGCATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026842
VALIDATED
UBQLN1 MISSION shRNA Lentiviral Transduction Particles
ubiquilin 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026842.3-526s1c1
Sequence:CCGGCCAGAAGTCAGATTTCAGCAACTCGAGTTGCTGAAATCTGACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026842.3-519s1c1
Sequence:CCGGGCAGAGTCCAGAAGTCAGATTCTCGAGAATCTGACTTCTGGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026842.3-1528s1c1
Sequence:CCGGCGGTTCTAATTGCCATATAAACTCGAGTTTATATGGCAATTAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026842.3-410s1c1
Sequence:CCGGGCACTGCACCTAGTGAAGATACTCGAGTATCTTCACTAGGTGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026842.3-623s1c1
Sequence:CCGGACATCAATGCAGCAATCGAAACTCGAGTTTCGATTGCTGCATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026842.3-519s21c1
Sequence:CCGGGCAGAGTCCAGAAGTCAGATTCTCGAGAATCTGACTTCTGGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026842.3-1528s21c1
Sequence:CCGGCGGTTCTAATTGCCATATAAACTCGAGTTTATATGGCAATTAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026842.3-410s21c1
Sequence:CCGGGCACTGCACCTAGTGAAGATACTCGAGTATCTTCACTAGGTGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026842.3-623s21c1
Sequence:CCGGACATCAATGCAGCAATCGAAACTCGAGTTTCGATTGCTGCATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013438
VALIDATED
UBQLN1 MISSION shRNA Bacterial Glycerol Stock
ubiquilin 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013438.x-1886s1c1
Sequence:CCGGCCTCAGCTACAGAATCCAGAACTCGAGTTCTGGATTCTGTAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_013438.x-1586s1c1
Sequence:CCGGCTCCCAACTTTCCTCCAACAACTCGAGTTGTTGGAGGAAAGTTGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013438.x-742s1c1
Sequence:CCGGAGGTCTGAGTAGCTTGGGTTTCTCGAGAAACCCAAGCTACTCAGACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_013438.x-1663s1c1
Sequence:CCGGGTTACAGATTCAGCAGGGTTTCTCGAGAAACCCTGCTGAATCTGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013438.x-2894s1c1
Sequence:CCGGGCTTCTCCCATAGGTAGTTTACTCGAGTAAACTACCTATGGGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013438.4-1641s21c1
Sequence:CCGGAGAGTACTACTGCGCCAAATTCTCGAGAATTTGGCGCAGTAGTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013438.4-794s21c1
Sequence:CCGGGACCAACTTGTGTTGATATTTCTCGAGAAATATCAACACAAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013438
VALIDATED
UBQLN1 MISSION shRNA shRNA Plasmid DNA
ubiquilin 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013438.x-1886s1c1
Sequence:CCGGCCTCAGCTACAGAATCCAGAACTCGAGTTCTGGATTCTGTAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_013438.x-1586s1c1
Sequence:CCGGCTCCCAACTTTCCTCCAACAACTCGAGTTGTTGGAGGAAAGTTGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013438.x-742s1c1
Sequence:CCGGAGGTCTGAGTAGCTTGGGTTTCTCGAGAAACCCAAGCTACTCAGACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_013438.x-1663s1c1
Sequence:CCGGGTTACAGATTCAGCAGGGTTTCTCGAGAAACCCTGCTGAATCTGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013438.x-2894s1c1
Sequence:CCGGGCTTCTCCCATAGGTAGTTTACTCGAGTAAACTACCTATGGGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013438.4-1641s21c1
Sequence:CCGGAGAGTACTACTGCGCCAAATTCTCGAGAATTTGGCGCAGTAGTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013438.4-794s21c1
Sequence:CCGGGACCAACTTGTGTTGATATTTCTCGAGAAATATCAACACAAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013438
VALIDATED
UBQLN1 MISSION shRNA Lentiviral Transduction Particles
ubiquilin 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013438.x-1886s1c1
Sequence:CCGGCCTCAGCTACAGAATCCAGAACTCGAGTTCTGGATTCTGTAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_013438.x-1586s1c1
Sequence:CCGGCTCCCAACTTTCCTCCAACAACTCGAGTTGTTGGAGGAAAGTTGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013438.x-742s1c1
Sequence:CCGGAGGTCTGAGTAGCTTGGGTTTCTCGAGAAACCCAAGCTACTCAGACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_013438.x-1663s1c1
Sequence:CCGGGTTACAGATTCAGCAGGGTTTCTCGAGAAACCCTGCTGAATCTGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013438.x-2894s1c1
Sequence:CCGGGCTTCTCCCATAGGTAGTTTACTCGAGTAAACTACCTATGGGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013438.4-1641s21c1
Sequence:CCGGAGAGTACTACTGCGCCAAATTCTCGAGAATTTGGCGCAGTAGTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013438.4-794s21c1
Sequence:CCGGGACCAACTTGTGTTGATATTTCTCGAGAAATATCAACACAAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks