EMAIL THIS PAGE TO A FRIEND

UBQLN2

ubiquilin 2

Synonyms: ALS15 CHAP1 DSK2 N4BP4 PLIC2
UniProtKB ID: Q9UHD9, O94798, Q5D027, Q9H3W6, Q9HAZ4
Gene ID:
Human(29978) Summary: This gene encodes an ubiquitin-like protein (ubiquilin) that shares high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain a N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases; and thus, are thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This ubiquilin has also been shown to bind the ATPase domain of the Hsp70-like Stch protein. [provided by RefSeq, Oct 2009]
Mouse(54609) ubiquilin 2
Rat(317396) ubiquilin 2
chicken(419078) ubiquilin 2
Horse(100050402) ubiquilin 2
dog(491909) ubiquilin 2
cow(539529) ubiquilin 2
sheep(101114677) ubiquilin 2
135 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018798 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018798 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018798 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013444 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013444 Rosetta Predictions human pricing
NM_001108251 Rosetta Predictions rat pricing
NM_018798 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115238 predicted 1036
2 SASI_Hs01_00115239 predicted 633
3 SASI_Hs01_00115240 predicted 622
4 SASI_Hs01_00115241 predicted 815
5 SASI_Hs01_00115242 predicted 838
6 SASI_Hs02_00344850 predicted 766
7 SASI_Hs01_00115243 predicted 1465
8 SASI_Hs01_00115244 predicted 899
9 SASI_Hs02_00344851 predicted 1298
10 SASI_Hs01_00115245 predicted 831
11 SASI_Hs01_00115246 predicted 1219
12 SASI_Hs01_00115247 predicted 1590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108251 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236814 predicted 462
2 SASI_Rn02_00236815 predicted 2102
3 SASI_Rn02_00236816 predicted 904
4 SASI_Rn02_00236817 predicted 1965
5 SASI_Rn02_00236818 predicted 993
6 SASI_Rn02_00236819 predicted 452
7 SASI_Rn02_00236820 predicted 728
8 SASI_Rn02_00236821 predicted 465
9 SASI_Rn02_00236822 predicted 478
10 SASI_Rn02_00236823 predicted 1647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086301 predicted 832
2 SASI_Mm02_00324122 predicted 1488
3 SASI_Mm01_00086302 predicted 1326
4 SASI_Mm01_00086304 predicted 921
5 SASI_Mm01_00086305 predicted 738
6 SASI_Mm01_00086306 predicted 1582
7 SASI_Mm01_00086307 predicted 1059
8 SASI_Mm02_00324123 predicted 397
9 SASI_Mm01_00086308 predicted 1470
10 SASI_Mm01_00086309 predicted 866
11 SASI_Mm01_00086303 predicted 402
12 SASI_Mm01_00086310 predicted 1902
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018798
VALIDATED
UBQLN2 MISSION shRNA Bacterial Glycerol Stock
ubiquilin 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018798.2-2059s21c1
Sequence:CCGGGCAAACTTGCAGGCCCTAATACTCGAGTATTAGGGCCTGCAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018798.2-925s21c1
Sequence:CCGGCTACTGAACAACCCAGATATACTCGAGTATATCTGGGTTGTTCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018798.2-1927s21c1
Sequence:CCGGCCCAACCAGCAGTTCATTCAACTCGAGTTGAATGAACTGCTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018798.2-2864s21c1
Sequence:CCGGGCTAGGTATGTCTCACAATTTCTCGAGAAATTGTGAGACATACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018798.2-2864s1c1
Sequence:CCGGGCTAGGTATGTCTCACAATTTCTCGAGAAATTGTGAGACATACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018798.2-1927s1c1
Sequence:CCGGCCCAACCAGCAGTTCATTCAACTCGAGTTGAATGAACTGCTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018798.2-925s1c1
Sequence:CCGGCTACTGAACAACCCAGATATACTCGAGTATATCTGGGTTGTTCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018798.2-924s1c1
Sequence:CCGGCCTACTGAACAACCCAGATATCTCGAGATATCTGGGTTGTTCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018798.2-2059s1c1
Sequence:CCGGGCAAACTTGCAGGCCCTAATACTCGAGTATTAGGGCCTGCAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018798
VALIDATED
UBQLN2 MISSION shRNA shRNA Plasmid DNA
ubiquilin 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018798.2-2059s21c1
Sequence:CCGGGCAAACTTGCAGGCCCTAATACTCGAGTATTAGGGCCTGCAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018798.2-925s21c1
Sequence:CCGGCTACTGAACAACCCAGATATACTCGAGTATATCTGGGTTGTTCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018798.2-1927s21c1
Sequence:CCGGCCCAACCAGCAGTTCATTCAACTCGAGTTGAATGAACTGCTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018798.2-2864s21c1
Sequence:CCGGGCTAGGTATGTCTCACAATTTCTCGAGAAATTGTGAGACATACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018798.2-2864s1c1
Sequence:CCGGGCTAGGTATGTCTCACAATTTCTCGAGAAATTGTGAGACATACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018798.2-1927s1c1
Sequence:CCGGCCCAACCAGCAGTTCATTCAACTCGAGTTGAATGAACTGCTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018798.2-925s1c1
Sequence:CCGGCTACTGAACAACCCAGATATACTCGAGTATATCTGGGTTGTTCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018798.2-924s1c1
Sequence:CCGGCCTACTGAACAACCCAGATATCTCGAGATATCTGGGTTGTTCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018798.2-2059s1c1
Sequence:CCGGGCAAACTTGCAGGCCCTAATACTCGAGTATTAGGGCCTGCAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018798
VALIDATED
UBQLN2 MISSION shRNA Lentiviral Transduction Particles
ubiquilin 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018798.2-2059s21c1
Sequence:CCGGGCAAACTTGCAGGCCCTAATACTCGAGTATTAGGGCCTGCAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018798.2-925s21c1
Sequence:CCGGCTACTGAACAACCCAGATATACTCGAGTATATCTGGGTTGTTCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018798.2-1927s21c1
Sequence:CCGGCCCAACCAGCAGTTCATTCAACTCGAGTTGAATGAACTGCTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018798.2-2864s21c1
Sequence:CCGGGCTAGGTATGTCTCACAATTTCTCGAGAAATTGTGAGACATACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018798.2-2864s1c1
Sequence:CCGGGCTAGGTATGTCTCACAATTTCTCGAGAAATTGTGAGACATACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018798.2-1927s1c1
Sequence:CCGGCCCAACCAGCAGTTCATTCAACTCGAGTTGAATGAACTGCTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018798.2-925s1c1
Sequence:CCGGCTACTGAACAACCCAGATATACTCGAGTATATCTGGGTTGTTCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018798.2-924s1c1
Sequence:CCGGCCTACTGAACAACCCAGATATCTCGAGATATCTGGGTTGTTCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018798.2-2059s1c1
Sequence:CCGGGCAAACTTGCAGGCCCTAATACTCGAGTATTAGGGCCTGCAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013444
VALIDATED
UBQLN2 MISSION shRNA Bacterial Glycerol Stock
ubiquilin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013444.2-399s21c1
Sequence:CCGGAGCAGTTTAAGGAAGCGATTTCTCGAGAAATCGCTTCCTTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013444.2-965s21c1
Sequence:CCGGATGCAAGAGATGATGAGAAATCTCGAGATTTCTCATCATCTCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013444.2-424s21c1
Sequence:CCGGACGCTTCAAATCCCAAACCGACTCGAGTCGGTTTGGGATTTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013444.2-1642s21c1
Sequence:CCGGACCTGGCCTGATTCCGAGCTTCTCGAGAAGCTCGGAATCAGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013444.2-627s21c1
Sequence:CCGGGTAACTCCACACCTATTTCCACTCGAGTGGAAATAGGTGTGGAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_013444.x-399s1c1
Sequence:CCGGAGCAGTTTAAGGAAGCGATTTCTCGAGAAATCGCTTCCTTAAACTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_013444.x-1642s1c1
Sequence:CCGGACCTGGCCTGATTCCGAGCTTCTCGAGAAGCTCGGAATCAGGCCAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_013444.x-424s1c1
Sequence:CCGGACGCTTCAAATCCCAAACCGACTCGAGTCGGTTTGGGATTTGAAGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_013444.x-627s1c1
Sequence:CCGGGTAACTCCACACCTATTTCCACTCGAGTGGAAATAGGTGTGGAGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_013444.x-965s1c1
Sequence:CCGGATGCAAGAGATGATGAGAAATCTCGAGATTTCTCATCATCTCTTGCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013444
VALIDATED
UBQLN2 MISSION shRNA shRNA Plasmid DNA
ubiquilin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013444.2-399s21c1
Sequence:CCGGAGCAGTTTAAGGAAGCGATTTCTCGAGAAATCGCTTCCTTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013444.2-965s21c1
Sequence:CCGGATGCAAGAGATGATGAGAAATCTCGAGATTTCTCATCATCTCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013444.2-424s21c1
Sequence:CCGGACGCTTCAAATCCCAAACCGACTCGAGTCGGTTTGGGATTTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013444.2-1642s21c1
Sequence:CCGGACCTGGCCTGATTCCGAGCTTCTCGAGAAGCTCGGAATCAGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013444.2-627s21c1
Sequence:CCGGGTAACTCCACACCTATTTCCACTCGAGTGGAAATAGGTGTGGAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_013444.x-399s1c1
Sequence:CCGGAGCAGTTTAAGGAAGCGATTTCTCGAGAAATCGCTTCCTTAAACTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_013444.x-1642s1c1
Sequence:CCGGACCTGGCCTGATTCCGAGCTTCTCGAGAAGCTCGGAATCAGGCCAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_013444.x-424s1c1
Sequence:CCGGACGCTTCAAATCCCAAACCGACTCGAGTCGGTTTGGGATTTGAAGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_013444.x-627s1c1
Sequence:CCGGGTAACTCCACACCTATTTCCACTCGAGTGGAAATAGGTGTGGAGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_013444.x-965s1c1
Sequence:CCGGATGCAAGAGATGATGAGAAATCTCGAGATTTCTCATCATCTCTTGCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013444
VALIDATED
UBQLN2 MISSION shRNA Lentiviral Transduction Particles
ubiquilin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013444.2-399s21c1
Sequence:CCGGAGCAGTTTAAGGAAGCGATTTCTCGAGAAATCGCTTCCTTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013444.2-965s21c1
Sequence:CCGGATGCAAGAGATGATGAGAAATCTCGAGATTTCTCATCATCTCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013444.2-424s21c1
Sequence:CCGGACGCTTCAAATCCCAAACCGACTCGAGTCGGTTTGGGATTTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013444.2-1642s21c1
Sequence:CCGGACCTGGCCTGATTCCGAGCTTCTCGAGAAGCTCGGAATCAGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013444.2-627s21c1
Sequence:CCGGGTAACTCCACACCTATTTCCACTCGAGTGGAAATAGGTGTGGAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_013444.x-399s1c1
Sequence:CCGGAGCAGTTTAAGGAAGCGATTTCTCGAGAAATCGCTTCCTTAAACTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_013444.x-1642s1c1
Sequence:CCGGACCTGGCCTGATTCCGAGCTTCTCGAGAAGCTCGGAATCAGGCCAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_013444.x-424s1c1
Sequence:CCGGACGCTTCAAATCCCAAACCGACTCGAGTCGGTTTGGGATTTGAAGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_013444.x-627s1c1
Sequence:CCGGGTAACTCCACACCTATTTCCACTCGAGTGGAAATAGGTGTGGAGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_013444.x-965s1c1
Sequence:CCGGATGCAAGAGATGATGAGAAATCTCGAGATTTCTCATCATCTCTTGCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks