EMAIL THIS PAGE TO A FRIEND

UBQLN3

ubiquilin 3

Synonyms: TUP-1
UniProtKB ID: Q9H347, Q9NRE0
Gene ID:
Human(50613) Summary: Summary: This gene encodes an ubiquitin-like protein (ubiquilin) that shares high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain a N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis, and proposed to regulate cell-cycle progression during spermatogenesis. [provided by RefSeq, Jul 2008]
Mouse(244178) ubiquilin 3
Rat(308905) ubiquilin 3
cow(617845) ubiquilin 3
sheep(101120438) ubiquilin 3
dog(476826) ubiquilin 3
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198623 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198623 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198623 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017481 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044731 MISSION® esiRNA esiRNA human UBQLN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017481 Rosetta Predictions human pricing
NM_001107543 Rosetta Predictions rat pricing
NM_198623 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189288 predicted 698
2 SASI_Hs02_00350087 predicted 851
3 SASI_Hs01_00189289 predicted 1393
4 SASI_Hs01_00189292 predicted 2092
5 SASI_Hs01_00189293 predicted 1430
6 SASI_Hs01_00189294 predicted 1864
7 SASI_Hs01_00189295 predicted 896
8 SASI_Hs01_00189296 predicted 1090
9 SASI_Hs01_00189297 predicted 261
10 SASI_Hs02_00350088 predicted 806
11 SASI_Hs01_00189290 predicted 2062
12 SASI_Hs01_00189291 predicted 1382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229865 predicted 651
2 SASI_Rn02_00229866 predicted 1071
3 SASI_Rn02_00229867 predicted 1569
4 SASI_Rn02_00229868 predicted 270
5 SASI_Rn02_00229869 predicted 1109
6 SASI_Rn02_00229870 predicted 1290
7 SASI_Rn02_00229871 predicted 1617
8 SASI_Rn02_00229872 predicted 1831
9 SASI_Rn02_00229873 predicted 582
10 SASI_Rn02_00229874 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198623 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140637 predicted 1277
2 SASI_Mm02_00351071 predicted 977
3 SASI_Mm01_00140638 predicted 281
4 SASI_Mm01_00140639 predicted 1582
5 SASI_Mm01_00140640 predicted 2082
6 SASI_Mm01_00140641 predicted 1133
7 SASI_Mm01_00140642 predicted 718
8 SASI_Mm01_00140643 predicted 917
9 SASI_Mm01_00140644 predicted 1301
10 SASI_Mm01_00140645 predicted 1635
11 SASI_Mm01_00140646 predicted 1230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198623
UBQLN3 MISSION shRNA Bacterial Glycerol Stock
ubiquilin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198623.1-2092s1c1
Sequence:CCGGGCTCTAGTTATTTGGACCATACTCGAGTATGGTCCAAATAACTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198623.1-1445s1c1
Sequence:CCGGCCCAATCTTACCTCTCAGATACTCGAGTATCTGAGAGGTAAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198623.1-874s1c1
Sequence:CCGGCCGTACTATGTACACAGATATCTCGAGATATCTGTGTACATAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198623.1-463s1c1
Sequence:CCGGCCCTCAGTCAAGTTCTGTTTACTCGAGTAAACAGAACTTGACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198623.1-1590s1c1
Sequence:CCGGGCACAAATCAAGTCCCTCGAACTCGAGTTCGAGGGACTTGATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198623
UBQLN3 MISSION shRNA shRNA Plasmid DNA
ubiquilin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198623.1-2092s1c1
Sequence:CCGGGCTCTAGTTATTTGGACCATACTCGAGTATGGTCCAAATAACTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198623.1-1445s1c1
Sequence:CCGGCCCAATCTTACCTCTCAGATACTCGAGTATCTGAGAGGTAAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198623.1-874s1c1
Sequence:CCGGCCGTACTATGTACACAGATATCTCGAGATATCTGTGTACATAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198623.1-463s1c1
Sequence:CCGGCCCTCAGTCAAGTTCTGTTTACTCGAGTAAACAGAACTTGACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198623.1-1590s1c1
Sequence:CCGGGCACAAATCAAGTCCCTCGAACTCGAGTTCGAGGGACTTGATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198623
UBQLN3 MISSION shRNA Lentiviral Transduction Particles
ubiquilin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198623.1-2092s1c1
Sequence:CCGGGCTCTAGTTATTTGGACCATACTCGAGTATGGTCCAAATAACTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198623.1-1445s1c1
Sequence:CCGGCCCAATCTTACCTCTCAGATACTCGAGTATCTGAGAGGTAAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198623.1-874s1c1
Sequence:CCGGCCGTACTATGTACACAGATATCTCGAGATATCTGTGTACATAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198623.1-463s1c1
Sequence:CCGGCCCTCAGTCAAGTTCTGTTTACTCGAGTAAACAGAACTTGACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198623.1-1590s1c1
Sequence:CCGGGCACAAATCAAGTCCCTCGAACTCGAGTTCGAGGGACTTGATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017481
UBQLN3 MISSION shRNA Bacterial Glycerol Stock
ubiquilin 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017481.x-1282s1c1
Sequence:CCGGAGTCAGTAGCAATCAAGGGAACTCGAGTTCCCTTGATTGCTACTGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017481.x-2056s1c1
Sequence:CCGGAGCCTTATTCATTCAAACCATCTCGAGATGGTTTGAATGAATAAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017481.x-269s1c1
Sequence:CCGGTGTTCTAATCTTTGCTGGCAACTCGAGTTGCCAGCAAAGATTAGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017481.x-1569s1c1
Sequence:CCGGCCACAGTTACAGGATGAGATACTCGAGTATCTCATCCTGTAACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017481.x-1110s1c1
Sequence:CCGGCTCTATGACTATCTCCAGCAACTCGAGTTGCTGGAGATAGTCATAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017481
UBQLN3 MISSION shRNA shRNA Plasmid DNA
ubiquilin 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017481.x-1282s1c1
Sequence:CCGGAGTCAGTAGCAATCAAGGGAACTCGAGTTCCCTTGATTGCTACTGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017481.x-2056s1c1
Sequence:CCGGAGCCTTATTCATTCAAACCATCTCGAGATGGTTTGAATGAATAAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017481.x-269s1c1
Sequence:CCGGTGTTCTAATCTTTGCTGGCAACTCGAGTTGCCAGCAAAGATTAGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017481.x-1569s1c1
Sequence:CCGGCCACAGTTACAGGATGAGATACTCGAGTATCTCATCCTGTAACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017481.x-1110s1c1
Sequence:CCGGCTCTATGACTATCTCCAGCAACTCGAGTTGCTGGAGATAGTCATAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017481
UBQLN3 MISSION shRNA Lentiviral Transduction Particles
ubiquilin 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017481.x-1282s1c1
Sequence:CCGGAGTCAGTAGCAATCAAGGGAACTCGAGTTCCCTTGATTGCTACTGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017481.x-2056s1c1
Sequence:CCGGAGCCTTATTCATTCAAACCATCTCGAGATGGTTTGAATGAATAAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017481.x-269s1c1
Sequence:CCGGTGTTCTAATCTTTGCTGGCAACTCGAGTTGCCAGCAAAGATTAGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017481.x-1569s1c1
Sequence:CCGGCCACAGTTACAGGATGAGATACTCGAGTATCTCATCCTGTAACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017481.x-1110s1c1
Sequence:CCGGCTCTATGACTATCTCCAGCAACTCGAGTTGCTGGAGATAGTCATAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks